Orthologous regulated operons containing SO2586 gene

Properties
Regulog:	Crp - Shewanellaceae
Regulator type:	Transcription factor
Regulator family:	CRP
Regulation mode:	repressor (activator)
Biological process:	Carbon catabolism
Effector:	Cyclic 3',5'-AMP
Phylum:	Proteobacteria

Built upon 2713 sites [see more]

Orthologous operons
Operon	Position	Score	Sequence	Locus Tag of the First Gene
Shewanella baltica OS155
Position: -205 Score: 4.28645 Sequence: ATCATTGACTTAGATCACATAA Locus tag: Sbal_1859 Name: SO2586 Funciton: inactive homolog of metal-dependent proteases, putative molecular chaperone Locus tag: Sbal_1860 Name: SO2585 Funciton: hypothetical protein Locus tag: Sbal_1861 Name: SO2584 Funciton: Tlr1621 protein
SO2586-SO2585-SO2584	-205	4.3	ATCATTGACTTAGATCACATAA	Sbal_1859
Shewanella oneidensis MR-1
Position: -177 Score: 4.07914 Sequence: GTTAGTGATAGCGATCACAAAC Locus tag: SO2586 Name: SO2586 Funciton: inactive homolog of metal-dependent proteases, putative molecular chaperone Locus tag: SO2585 Name: SO2585 Funciton: hypothetical protein Locus tag: SO2584 Name: SO2584 Funciton: Tlr1621 protein
SO2586-SO2585-SO2584	-177	4.1	GTTAGTGATAGCGATCACAAAC	SO2586
Shewanella putrefaciens CN-32
Position: -269 Score: 4.72632 Sequence: TTAAGTGACTTATATCACATTG Locus tag: Sputcn32_1756 Name: SO2586 Funciton: inactive homolog of metal-dependent proteases, putative molecular chaperone Locus tag: Sputcn32_1757 Name: SO2585 Funciton: hypothetical protein Locus tag: Sputcn32_1758 Name: SO2584 Funciton: Tlr1621 protein
SO2586-SO2585-SO2584	-269	4.7	TTAAGTGACTTATATCACATTG	Sputcn32_1756
Shewanella sp ANA-3
Position: -176 Score: 4.15281 Sequence: GTTAGTGATGGCGATCACAAAC Locus tag: Shewana3_2391 Name: SO2586 Funciton: inactive homolog of metal-dependent proteases, putative molecular chaperone Locus tag: Shewana3_2390 Name: SO2585 Funciton: hypothetical protein Locus tag: Shewana3_2389 Name: SO2584 Funciton: Tlr1621 protein
SO2586-SO2585-SO2584	-176	4.2	GTTAGTGATGGCGATCACAAAC	Shewana3_2391
Shewanella sp MR-4
Position: -177 Score: 4.15281 Sequence: GTTAGTGATGGCGATCACAAAC Locus tag: Shewmr4_2182 Name: SO2586 Funciton: inactive homolog of metal-dependent proteases, putative molecular chaperone Locus tag: Shewmr4_2181 Name: SO2585 Funciton: hypothetical protein Locus tag: Shewmr4_2180 Name: SO2584 Funciton: Tlr1621 protein
SO2586-SO2585-SO2584	-177	4.2	GTTAGTGATGGCGATCACAAAC	Shewmr4_2182
Shewanella sp MR-7
Position: -178 Score: 4.15281 Sequence: GTTAGTGATGGCGATCACAAAC Locus tag: Shewmr7_2259 Name: SO2586 Funciton: inactive homolog of metal-dependent proteases, putative molecular chaperone Locus tag: Shewmr7_2258 Name: SO2585 Funciton: hypothetical protein Locus tag: Shewmr7_2257 Name: SO2584 Funciton: Tlr1621 protein
SO2586-SO2585-SO2584	-178	4.2	GTTAGTGATGGCGATCACAAAC	Shewmr7_2259
Shewanella sp W3-18-1
Position: -269 Score: 4.72632 Sequence: TTAAGTGACTTATATCACATTG Locus tag: Sputw3181_2269 Name: SO2586 Funciton: inactive homolog of metal-dependent proteases, putative molecular chaperone Locus tag: Sputw3181_2268 Name: SO2585 Funciton: hypothetical protein Locus tag: Sputw3181_2267 Name: SO2584 Funciton: Tlr1621 protein
SO2586-SO2585-SO2584	-269	4.7	TTAAGTGACTTATATCACATTG	Sputw3181_2269

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --

Orthologous regulated operons containing SO2586 gene

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --