Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Orthologous regulated operons containing napG gene

Properties
Regulog: Crp - Shewanellaceae
Regulator type: Transcription factor
Regulator family: CRP
Regulation mode: repressor (activator)
Biological process: Carbon catabolism
Effector: Cyclic 3',5'-AMP
Phylum: Proteobacteria
Built upon 2713 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Shewanella halifaxensis HAW-EB4
Position: -174
Score: 4.1821
Sequence: ATCTGTGAATCAGATCACCATG
Locus tag: Shal_0716
Name: napD
Funciton: periplasmic nitrate reductase component NapD
Locus tag: Shal_0715
Name: napA
Funciton: periplasmic nitrate reductase precursor (EC 1.7.99.4)
Locus tag: Shal_0714
Name: napG
Funciton: ferredoxin-type protein NapG (periplasmic nitrate reductase)
Locus tag: Shal_0713
Name: napH
Funciton: polyferredoxin NapH (periplasmic nitrate reductase)
Locus tag: Shal_0712
Name: napB
Funciton: nitrate reductase cytochrome c550-type subunit
napD-napA-napG-napH-napB -174 4.2 ATCTGTGAATCAGATCACCATG Shal_0716
Shewanella loihica PV-4
Position: -154
Score: 3.77479
Sequence: AACTTTGATCTCGATCTACAAA
Locus tag: Shew_3205
Name: napD
Funciton: periplasmic nitrate reductase component NapD
Locus tag: Shew_3206
Name: napA
Funciton: periplasmic nitrate reductase precursor (EC 1.7.99.4)
Locus tag: Shew_3207
Name: napG
Funciton: ferredoxin-type protein NapG (periplasmic nitrate reductase)
Locus tag: Shew_3208
Name: napH
Funciton: polyferredoxin NapH (periplasmic nitrate reductase)
Locus tag: Shew_3209
Name: napB
Funciton: nitrate reductase cytochrome c550-type subunit
napD-napA-napG-napH-napB -154 3.8 AACTTTGATCTCGATCTACAAA Shew_3205
Shewanella oneidensis MR-1
Position: -260
Score: 3.931
Sequence: TAATGTGATTGGTATAAACCTC
Position: -150
Score: 3.89406
Sequence: AACTTTGATCCCGATCGACTAT
Locus tag: SO0849
Name: napD
Funciton: periplasmic nitrate reductase component NapD
Locus tag: SO0848
Name: napA
Funciton: periplasmic nitrate reductase precursor (EC 1.7.99.4)
Locus tag: SO0847
Name: napG
Funciton: ferredoxin-type protein NapG (periplasmic nitrate reductase)
Locus tag: SO0846
Name: napH
Funciton: polyferredoxin NapH (periplasmic nitrate reductase)
Locus tag: SO0845
Name: napB
Funciton: nitrate reductase cytochrome c550-type subunit
napD-napA-napG-napH-napB -260 3.9 TAATGTGATTGGTATAAACCTC SO0849
-150 3.9 AACTTTGATCCCGATCGACTAT
Shewanella pealeana ATCC 700345
Position: -173
Score: 4.2894
Sequence: ATTTGTGAACTAGATCAACACT
Locus tag: Spea_0624
Name: napD
Funciton: periplasmic nitrate reductase component NapD
Locus tag: Spea_0623
Name: napA
Funciton: periplasmic nitrate reductase precursor (EC 1.7.99.4)
Locus tag: Spea_0622
Name: napG
Funciton: ferredoxin-type protein NapG (periplasmic nitrate reductase)
Locus tag: Spea_0621
Name: napH
Funciton: polyferredoxin NapH (periplasmic nitrate reductase)
Locus tag: Spea_0620
Name: napB
Funciton: nitrate reductase cytochrome c550-type subunit
napD-napA-napG-napH-napB -173 4.3 ATTTGTGAACTAGATCAACACT Spea_0624
Shewanella putrefaciens CN-32
Position: -147
Score: 3.89406
Sequence: AACTTTGATCCCGATCGACTAT
Locus tag: Sputcn32_3147
Name: napD
Funciton: periplasmic nitrate reductase component NapD
Locus tag: Sputcn32_3148
Name: napA
Funciton: periplasmic nitrate reductase precursor (EC 1.7.99.4)
Locus tag: Sputcn32_3149
Name: napG
Funciton: ferredoxin-type protein NapG (periplasmic nitrate reductase)
Locus tag: Sputcn32_3150
Name: napH
Funciton: polyferredoxin NapH (periplasmic nitrate reductase)
Locus tag: Sputcn32_3151
Name: napB
Funciton: nitrate reductase cytochrome c550-type subunit
napD-napA-napG-napH-napB -147 3.9 AACTTTGATCCCGATCGACTAT Sputcn32_3147
Shewanella sediminis HAW-EB3
Position: -187
Score: 4.11887
Sequence: ATCTGAGACATAGGTCACACAT
Locus tag: Ssed_3956
Name: napD
Funciton: periplasmic nitrate reductase component NapD
Locus tag: Ssed_3957
Name: napA
Funciton: periplasmic nitrate reductase precursor (EC 1.7.99.4)
Locus tag: Ssed_3958
Name: napG
Funciton: ferredoxin-type protein NapG (periplasmic nitrate reductase)
Locus tag: Ssed_3959
Name: napH
Funciton: polyferredoxin NapH (periplasmic nitrate reductase)
Locus tag: Ssed_3960
Name: napB
Funciton: nitrate reductase cytochrome c550-type subunit
napD-napA-napG-napH-napB -187 4.1 ATCTGAGACATAGGTCACACAT Ssed_3956
Shewanella sp ANA-3
Position: -149
Score: 3.89406
Sequence: AACTTTGATCCCGATCGACTAT
Locus tag: Shewana3_3429
Name: napD
Funciton: periplasmic nitrate reductase component NapD
Locus tag: Shewana3_3430
Name: napA
Funciton: periplasmic nitrate reductase precursor (EC 1.7.99.4)
Locus tag: Shewana3_3431
Name: napG
Funciton: ferredoxin-type protein NapG (periplasmic nitrate reductase)
Locus tag: Shewana3_3432
Name: napH
Funciton: polyferredoxin NapH (periplasmic nitrate reductase)
Locus tag: Shewana3_3433
Name: napB
Funciton: nitrate reductase cytochrome c550-type subunit
napD-napA-napG-napH-napB -149 3.9 AACTTTGATCCCGATCGACTAT Shewana3_3429
Shewanella sp MR-4
Position: -149
Score: 3.89406
Sequence: AACTTTGATCCCGATCGACTAT
Locus tag: Shewmr4_0705
Name: napD
Funciton: periplasmic nitrate reductase component NapD
Locus tag: Shewmr4_0704
Name: napA
Funciton: periplasmic nitrate reductase precursor (EC 1.7.99.4)
Locus tag: Shewmr4_0703
Name: napG
Funciton: ferredoxin-type protein NapG (periplasmic nitrate reductase)
Locus tag: Shewmr4_0702
Name: napH
Funciton: polyferredoxin NapH (periplasmic nitrate reductase)
Locus tag: Shewmr4_0701
Name: napB
Funciton: nitrate reductase cytochrome c550-type subunit
napD-napA-napG-napH-napB -149 3.9 AACTTTGATCCCGATCGACTAT Shewmr4_0705
Shewanella sp MR-7
Position: -149
Score: 3.89406
Sequence: AACTTTGATCCCGATCGACTAT
Locus tag: Shewmr7_3317
Name: napD
Funciton: periplasmic nitrate reductase component NapD
Locus tag: Shewmr7_3318
Name: napA
Funciton: periplasmic nitrate reductase precursor (EC 1.7.99.4)
Locus tag: Shewmr7_3319
Name: napG
Funciton: ferredoxin-type protein NapG (periplasmic nitrate reductase)
Locus tag: Shewmr7_3320
Name: napH
Funciton: polyferredoxin NapH (periplasmic nitrate reductase)
Locus tag: Shewmr7_3321
Name: napB
Funciton: nitrate reductase cytochrome c550-type subunit
napD-napA-napG-napH-napB -149 3.9 AACTTTGATCCCGATCGACTAT Shewmr7_3317
Shewanella sp W3-18-1
Position: -147
Score: 3.89406
Sequence: AACTTTGATCCCGATCGACTAT
Locus tag: Sputw3181_0796
Name: napD
Funciton: periplasmic nitrate reductase component NapD
Locus tag: Sputw3181_0795
Name: napA
Funciton: periplasmic nitrate reductase precursor (EC 1.7.99.4)
Locus tag: Sputw3181_0794
Name: napG
Funciton: ferredoxin-type protein NapG (periplasmic nitrate reductase)
Locus tag: Sputw3181_0793
Name: napH
Funciton: polyferredoxin NapH (periplasmic nitrate reductase)
Locus tag: Sputw3181_0792
Name: napB
Funciton: nitrate reductase cytochrome c550-type subunit
napD-napA-napG-napH-napB -147 3.9 AACTTTGATCCCGATCGACTAT Sputw3181_0796