Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Orthologous regulated operons containing Sden_0863 gene

Properties
Regulog: Crp - Shewanellaceae
Regulator type: Transcription factor
Regulator family: CRP
Regulation mode: repressor (activator)
Biological process: Carbon catabolism
Effector: Cyclic 3',5'-AMP
Phylum: Proteobacteria
Built upon 2713 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Shewanella halifaxensis HAW-EB4
Position: -36
Score: 4.29117
Sequence: AAATGGGATGTAAATAACGTAA
Locus tag: Shal_0814
Name: null
Funciton: nitroreductase
Locus tag: Shal_0815
Name: null
Funciton: Cupin 2 conserved barrel domain protein
Locus tag: Shal_0816
Name: SO3797
Funciton: probable collagenase (EC 3.4.24.3)
Shal_0814-Shal_0815-SO3797 -36 4.3 AAATGGGATGTAAATAACGTAA Shal_0814
© 2009-2020 RegPrecise