Orthologous regulated operons containing Shewana3_3248 gene

Properties
Regulog:	Crp - Shewanellaceae
Regulator type:	Transcription factor
Regulator family:	CRP
Regulation mode:	repressor (activator)
Biological process:	Carbon catabolism
Effector:	Cyclic 3',5'-AMP
Phylum:	Proteobacteria

Built upon 2713 sites [see more]

Orthologous operons
Operon	Position	Score	Sequence	Locus Tag of the First Gene
Shewanella baltica OS155
Position: -76 Score: 3.71864 Sequence: ATTTTTGAGCAATATCACGGCT Locus tag: Sbal_3331 Name: null Funciton: hypothetical protein Locus tag: Sbal_3330 Name: SO3681 Funciton: universal stress protein family Locus tag: Sbal_3329 Name: Shewana3_3248 Funciton: UspA domain-containing protein
Sbal_3331-SO3681-Shewana3_3248	-76	3.7	ATTTTTGAGCAATATCACGGCT	Sbal_3331
Shewanella halifaxensis HAW-EB4
Position: -90 Score: 4.77177 Sequence: AATTGTGACTGAGATCAAATTC Locus tag: Shal_3428 Name: null Funciton: hypothetical protein Locus tag: Shal_3427 Name: SO3681 Funciton: universal stress protein family Locus tag: Shal_3426 Name: Shewana3_3248 Funciton: UspA domain-containing protein
Shal_3428-SO3681-Shewana3_3248	-90	4.8	AATTGTGACTGAGATCAAATTC	Shal_3428
Shewanella oneidensis MR-1
Position: -109 Score: 3.80332 Sequence: TTGCGTGATTTTGTGCAAGCAT Locus tag: SO3682 Name: null Funciton: hypothetical protein Locus tag: SO3681 Name: SO3681 Funciton: universal stress protein family Locus tag: SO3680 Name: Shewana3_3248 Funciton: UspA domain-containing protein
SO3682-SO3681-Shewana3_3248	-109	3.8	TTGCGTGATTTTGTGCAAGCAT	SO3682
Shewanella pealeana ATCC 700345
Position: -102 Score: 4.73342 Sequence: AATTGTGAGCTAGATCAAACTC Locus tag: Spea_3356 Name: null Funciton: hypothetical protein Locus tag: Spea_3355 Name: SO3681 Funciton: universal stress protein family Locus tag: Spea_3354 Name: Shewana3_3248 Funciton: UspA domain-containing protein
Spea_3356-SO3681-Shewana3_3248	-102	4.7	AATTGTGAGCTAGATCAAACTC	Spea_3356
Shewanella sediminis HAW-EB3
Position: -111 Score: 4.2011 Sequence: CAGTGTGATCTCGATCAACTTC Locus tag: Ssed_3715 Name: null Funciton: hypothetical protein Locus tag: Ssed_3714 Name: SO3681 Funciton: universal stress protein family Locus tag: Ssed_3713 Name: Shewana3_3248 Funciton: UspA domain-containing protein
Ssed_3715-SO3681-Shewana3_3248	-111	4.2	CAGTGTGATCTCGATCAACTTC	Ssed_3715
Shewanella sp MR-4
Position: -166 Score: 3.67918 Sequence: TGACGTGATTTGTGGCGTATAA Locus tag: Shewmr4_0873 Name: null Funciton: hypothetical protein Locus tag: Shewmr4_0874 Name: SO3681 Funciton: universal stress protein family Locus tag: Shewmr4_0875 Name: Shewana3_3248 Funciton: UspA domain-containing protein
Shewmr4_0873-SO3681-Shewana3_3248	-166	3.7	TGACGTGATTTGTGGCGTATAA	Shewmr4_0873
Shewanella sp MR-7
Position: -166 Score: 3.67918 Sequence: TGACGTGATTTGTGGCGTATAA Locus tag: Shewmr7_3149 Name: null Funciton: hypothetical protein Locus tag: Shewmr7_3148 Name: SO3681 Funciton: universal stress protein family Locus tag: Shewmr7_3147 Name: Shewana3_3248 Funciton: UspA domain-containing protein
Shewmr7_3149-SO3681-Shewana3_3248	-166	3.7	TGACGTGATTTGTGGCGTATAA	Shewmr7_3149
Shewanella woodyi ATCC 51908
Position: -140 Score: 4.69834 Sequence: ATGTGTGATCAAGATCAACATT Locus tag: Swoo_4060 Name: SO3681 Funciton: universal stress protein family Locus tag: Swoo_4059 Name: Shewana3_3248 Funciton: UspA domain-containing protein
SO3681-Shewana3_3248	-140	4.7	ATGTGTGATCAAGATCAACATT	Swoo_4060

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --

Orthologous regulated operons containing Shewana3_3248 gene

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --