Orthologous regulated operons containing SO4126 gene

Properties
Regulog:	Crp - Shewanellaceae
Regulator type:	Transcription factor
Regulator family:	CRP
Regulation mode:	repressor (activator)
Biological process:	Carbon catabolism
Effector:	Cyclic 3',5'-AMP
Phylum:	Proteobacteria

Built upon 2713 sites [see more]

Orthologous operons
Operon	Position	Score	Sequence	Locus Tag of the First Gene
Shewanella baltica OS155
Position: -90 Score: 4.25106 Sequence: TTAATTGACCTAGATCAAACTT Locus tag: Sbal_3847 Name: null Funciton: hypothetical protein
Sbal_3847	-90	4.3	TTAATTGACCTAGATCAAACTT	Sbal_3847
Shewanella oneidensis MR-1
Position: -92 Score: 4.13908 Sequence: TTAATTGACCTAAATCAAACTT Locus tag: SO4126 Name: null Funciton: hypothetical protein
SO4126	-92	4.1	TTAATTGACCTAAATCAAACTT	SO4126
Shewanella putrefaciens CN-32
Position: -90 Score: 4.63786 Sequence: TAATTTGACCTAGATCAAAGTT Locus tag: Sputcn32_0548 Name: null Funciton: hypothetical protein
Sputcn32_0548	-90	4.6	TAATTTGACCTAGATCAAAGTT	Sputcn32_0548
Shewanella sp ANA-3
Position: -93 Score: 4.25106 Sequence: TTAATTGACCTAGATCAAACTT Locus tag: Shewana3_3675 Name: null Funciton: hypothetical protein
Shewana3_3675	-93	4.3	TTAATTGACCTAGATCAAACTT	Shewana3_3675
Shewanella sp MR-4
Position: -187 Score: 4.23469 Sequence: AACATTGAACTAGATCACAATT Position: -93 Score: 4.25106 Sequence: TTAATTGACCTAGATCAAACTT Locus tag: Shewmr4_3498 Name: null Funciton: hypothetical protein
Shewmr4_3498	-187	4.2	AACATTGAACTAGATCACAATT	Shewmr4_3498
	-93	4.3	TTAATTGACCTAGATCAAACTT
Shewanella sp MR-7
Position: -187 Score: 4.23469 Sequence: AACATTGAACTAGATCACAATT Position: -93 Score: 4.25106 Sequence: TTAATTGACCTAGATCAAACTT Locus tag: Shewmr7_0454 Name: null Funciton: hypothetical protein
Shewmr7_0454	-187	4.2	AACATTGAACTAGATCACAATT	Shewmr7_0454
	-93	4.3	TTAATTGACCTAGATCAAACTT
Shewanella sp W3-18-1
Position: -90 Score: 4.63786 Sequence: TAATTTGACCTAGATCAAAGTT Locus tag: Sputw3181_3624 Name: null Funciton: hypothetical protein
Sputw3181_3624	-90	4.6	TAATTTGACCTAGATCAAAGTT	Sputw3181_3624

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --

Orthologous regulated operons containing SO4126 gene

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --