Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Orthologous regulated operons containing ccmA gene

Properties
Regulog: Crp - Shewanellaceae
Regulator type: Transcription factor
Regulator family: CRP
Regulation mode: repressor (activator)
Biological process: Carbon catabolism
Effector: Cyclic 3',5'-AMP
Phylum: Proteobacteria
Built upon 2713 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Shewanella amazonensis SB2B
Position: -207
Score: 3.79572
Sequence: TTTTGTGAGTTCCCTCCCAGCT
Locus tag: Sama_0245
Name: ccmA
Funciton: ABC transporter involved in cytochrome c biogenesis, ATPase component CcmA
Locus tag: Sama_0244
Name: ccmB
Funciton: ABC transporter involved in cytochrome c biogenesis, CcmB subunit
Locus tag: Sama_0243
Name: ccmC
Funciton: cytochrome c-type biogenesis protein CcmC, putative heme lyase for CcmE
Locus tag: Sama_0242
Name: ccmD
Funciton: cytochrome c-type biogenesis protein CcmD, interacts with CcmCE
Locus tag: Sama_0241
Name: ccmE
Funciton: cytochrome c-type biogenesis protein CcmE, heme chaperone
ccmA-ccmB-ccmC-ccmD-ccmE -207 3.8 TTTTGTGAGTTCCCTCCCAGCT Sama_0245
Shewanella baltica OS155
Position: -212
Score: 4.44046
Sequence: TTTTGTGATTAGAATCTCAACA
Locus tag: Sbal_0228
Name: ccmA
Funciton: ABC transporter involved in cytochrome c biogenesis, ATPase component CcmA
Locus tag: Sbal_0227
Name: ccmB
Funciton: ABC transporter involved in cytochrome c biogenesis, CcmB subunit
Locus tag: Sbal_0226
Name: ccmC
Funciton: cytochrome c-type biogenesis protein CcmC, putative heme lyase for CcmE
Locus tag: Sbal_0225
Name: ccmD
Funciton: cytochrome c-type biogenesis protein CcmD, interacts with CcmCE
Locus tag: Sbal_0224
Name: ccmE
Funciton: cytochrome c-type biogenesis protein CcmE, heme chaperone
ccmA-ccmB-ccmC-ccmD-ccmE -212 4.4 TTTTGTGATTAGAATCTCAACA Sbal_0228
Shewanella denitrificans OS217
Position: -186
Score: 3.9967
Sequence: TTTTGTGATAAGCCTCCCAGCT
Locus tag: Sden_3569
Name: ccmA
Funciton: ABC transporter involved in cytochrome c biogenesis, ATPase component CcmA
Locus tag: Sden_3570
Name: ccmB
Funciton: ABC transporter involved in cytochrome c biogenesis, CcmB subunit
Locus tag: Sden_3571
Name: ccmC
Funciton: cytochrome c-type biogenesis protein CcmC, putative heme lyase for CcmE
Locus tag: Sden_3572
Name: ccmD
Funciton: cytochrome c-type biogenesis protein CcmD, interacts with CcmCE
Locus tag: Sden_3573
Name: ccmE
Funciton: cytochrome c-type biogenesis protein CcmE, heme chaperone
ccmA-ccmB-ccmC-ccmD-ccmE -186 4 TTTTGTGATAAGCCTCCCAGCT Sden_3569
Shewanella frigidimarina NCIMB 400
Position: -213
Score: 4.15994
Sequence: TTTTGTGATAACAATCTCAGCT
Locus tag: Sfri_0179
Name: ccmA
Funciton: ABC transporter involved in cytochrome c biogenesis, ATPase component CcmA
Locus tag: Sfri_0178
Name: ccmB
Funciton: ABC transporter involved in cytochrome c biogenesis, CcmB subunit
Locus tag: Sfri_0177
Name: ccmC
Funciton: cytochrome c-type biogenesis protein CcmC, putative heme lyase for CcmE
Locus tag: Sfri_0176
Name: ccmD
Funciton: cytochrome c-type biogenesis protein CcmD, interacts with CcmCE
Locus tag: Sfri_0175
Name: ccmE
Funciton: cytochrome c-type biogenesis protein CcmE, heme chaperone
ccmA-ccmB-ccmC-ccmD-ccmE -213 4.2 TTTTGTGATAACAATCTCAGCT Sfri_0179
Shewanella halifaxensis HAW-EB4
Position: -212
Score: 3.937
Sequence: TTTTGTGACATAAACCGTACTA
Position: -112
Score: 3.75256
Sequence: ATATTCGAACTACATCAAATTG
Locus tag: Shal_4104
Name: ccmA
Funciton: ABC transporter involved in cytochrome c biogenesis, ATPase component CcmA
Locus tag: Shal_4105
Name: ccmB
Funciton: ABC transporter involved in cytochrome c biogenesis, CcmB subunit
Locus tag: Shal_4106
Name: ccmC
Funciton: cytochrome c-type biogenesis protein CcmC, putative heme lyase for CcmE
Locus tag: Shal_4107
Name: ccmD
Funciton: cytochrome c-type biogenesis protein CcmD, interacts with CcmCE
Locus tag: Shal_4108
Name: ccmE
Funciton: cytochrome c-type biogenesis protein CcmE, heme chaperone
ccmA-ccmB-ccmC-ccmD-ccmE -212 3.9 TTTTGTGACATAAACCGTACTA Shal_4104
-112 3.8 ATATTCGAACTACATCAAATTG
Shewanella loihica PV-4
Position: -223
Score: 4.83884
Sequence: TTTTGTGATTAATATCAGAATT
Locus tag: Shew_0190
Name: ccmA
Funciton: ABC transporter involved in cytochrome c biogenesis, ATPase component CcmA
Locus tag: Shew_0189
Name: ccmB
Funciton: ABC transporter involved in cytochrome c biogenesis, CcmB subunit
Locus tag: Shew_0188
Name: ccmC
Funciton: cytochrome c-type biogenesis protein CcmC, putative heme lyase for CcmE
Locus tag: Shew_0187
Name: ccmD
Funciton: cytochrome c-type biogenesis protein CcmD, interacts with CcmCE
Locus tag: Shew_0186
Name: ccmE
Funciton: cytochrome c-type biogenesis protein CcmE, heme chaperone
ccmA-ccmB-ccmC-ccmD-ccmE -223 4.8 TTTTGTGATTAATATCAGAATT Shew_0190
Shewanella oneidensis MR-1
Position: -222
Score: 4.2202
Sequence: TTTTGTGATTAGAATCTCAGCA
Locus tag: SO0263
Name: ccmA
Funciton: ABC transporter involved in cytochrome c biogenesis, ATPase component CcmA
Locus tag: SO0262
Name: ccmB
Funciton: ABC transporter involved in cytochrome c biogenesis, CcmB subunit
Locus tag: SO0261
Name: ccmC
Funciton: cytochrome c-type biogenesis protein CcmC, putative heme lyase for CcmE
Locus tag: SO0260
Name: ccmD
Funciton: cytochrome c-type biogenesis protein CcmD, interacts with CcmCE
Locus tag: SO0259
Name: ccmE
Funciton: cytochrome c-type biogenesis protein CcmE, heme chaperone
ccmA-ccmB-ccmC-ccmD-ccmE -222 4.2 TTTTGTGATTAGAATCTCAGCA SO0263
Shewanella pealeana ATCC 700345
Position: -212
Score: 4.13455
Sequence: TTTTGTGATATTAATCTCGCCA
Position: -112
Score: 3.75256
Sequence: ATATTCGAACTACATCAAATTG
Locus tag: Spea_0215
Name: ccmA
Funciton: ABC transporter involved in cytochrome c biogenesis, ATPase component CcmA
Locus tag: Spea_0214
Name: ccmB
Funciton: ABC transporter involved in cytochrome c biogenesis, CcmB subunit
Locus tag: Spea_0213
Name: ccmC
Funciton: cytochrome c-type biogenesis protein CcmC, putative heme lyase for CcmE
Locus tag: Spea_0212
Name: ccmD
Funciton: cytochrome c-type biogenesis protein CcmD, interacts with CcmCE
Locus tag: Spea_0211
Name: ccmE
Funciton: cytochrome c-type biogenesis protein CcmE, heme chaperone
ccmA-ccmB-ccmC-ccmD-ccmE -212 4.1 TTTTGTGATATTAATCTCGCCA Spea_0215
-112 3.8 ATATTCGAACTACATCAAATTG
Shewanella piezotolerans WP3
Position: -212
Score: 5.00451
Sequence: ATTTGTGATTTAAATCGCGTTA
Position: -112
Score: 3.75256
Sequence: ATATTCGAACTACATCAAATTG
Locus tag: swp_2043
Name: ccmA
Funciton: ABC transporter involved in cytochrome c biogenesis, ATPase component CcmA
Locus tag: swp_2042
Name: ccmB
Funciton: ABC transporter involved in cytochrome c biogenesis, CcmB subunit
Locus tag: swp_2041
Name: ccmC
Funciton: cytochrome c-type biogenesis protein CcmC, putative heme lyase for CcmE
Locus tag: swp_2040
Name: ccmD
Funciton: cytochrome c-type biogenesis protein CcmD, interacts with CcmCE
Locus tag: swp_2039
Name: ccmE
Funciton: cytochrome c-type biogenesis protein CcmE, heme chaperone
ccmA-ccmB-ccmC-ccmD-ccmE -212 5 ATTTGTGATTTAAATCGCGTTA swp_2043
-112 3.8 ATATTCGAACTACATCAAATTG
Shewanella putrefaciens CN-32
Position: -213
Score: 3.91053
Sequence: TTTTGTGATTAGAATCTCAGCG
Locus tag: Sputcn32_3727
Name: ccmA
Funciton: ABC transporter involved in cytochrome c biogenesis, ATPase component CcmA
Locus tag: Sputcn32_3728
Name: ccmB
Funciton: ABC transporter involved in cytochrome c biogenesis, CcmB subunit
Locus tag: Sputcn32_3729
Name: ccmC
Funciton: cytochrome c-type biogenesis protein CcmC, putative heme lyase for CcmE
Locus tag: Sputcn32_3730
Name: ccmD
Funciton: cytochrome c-type biogenesis protein CcmD, interacts with CcmCE
Locus tag: Sputcn32_3731
Name: ccmE
Funciton: cytochrome c-type biogenesis protein CcmE, heme chaperone
ccmA-ccmB-ccmC-ccmD-ccmE -213 3.9 TTTTGTGATTAGAATCTCAGCG Sputcn32_3727
Shewanella sediminis HAW-EB3
Position: -223
Score: 4.49775
Sequence: TTTTGTGATTTCAATCAAAGCT
Locus tag: Ssed_4287
Name: ccmA
Funciton: ABC transporter involved in cytochrome c biogenesis, ATPase component CcmA
Locus tag: Ssed_4288
Name: ccmB
Funciton: ABC transporter involved in cytochrome c biogenesis, CcmB subunit
Locus tag: Ssed_4289
Name: ccmC
Funciton: cytochrome c-type biogenesis protein CcmC, putative heme lyase for CcmE
Locus tag: Ssed_4290
Name: ccmD
Funciton: cytochrome c-type biogenesis protein CcmD, interacts with CcmCE
Locus tag: Ssed_4291
Name: ccmE
Funciton: cytochrome c-type biogenesis protein CcmE, heme chaperone
ccmA-ccmB-ccmC-ccmD-ccmE -223 4.5 TTTTGTGATTTCAATCAAAGCT Ssed_4287
Shewanella sp ANA-3
Position: -222
Score: 4.2202
Sequence: TTTTGTGATTAGAATCTCAGCA
Locus tag: Shewana3_0231
Name: ccmA
Funciton: ABC transporter involved in cytochrome c biogenesis, ATPase component CcmA
Locus tag: Shewana3_0230
Name: ccmB
Funciton: ABC transporter involved in cytochrome c biogenesis, CcmB subunit
Locus tag: Shewana3_0229
Name: ccmC
Funciton: cytochrome c-type biogenesis protein CcmC, putative heme lyase for CcmE
Locus tag: Shewana3_0228
Name: ccmD
Funciton: cytochrome c-type biogenesis protein CcmD, interacts with CcmCE
Locus tag: Shewana3_0227
Name: ccmE
Funciton: cytochrome c-type biogenesis protein CcmE, heme chaperone
ccmA-ccmB-ccmC-ccmD-ccmE -222 4.2 TTTTGTGATTAGAATCTCAGCA Shewana3_0231
Shewanella sp MR-4
Position: -222
Score: 4.2202
Sequence: TTTTGTGATTAGAATCTCAGCA
Locus tag: Shewmr4_0231
Name: ccmA
Funciton: ABC transporter involved in cytochrome c biogenesis, ATPase component CcmA
Locus tag: Shewmr4_0230
Name: ccmB
Funciton: ABC transporter involved in cytochrome c biogenesis, CcmB subunit
Locus tag: Shewmr4_0229
Name: ccmC
Funciton: cytochrome c-type biogenesis protein CcmC, putative heme lyase for CcmE
Locus tag: Shewmr4_0228
Name: ccmD
Funciton: cytochrome c-type biogenesis protein CcmD, interacts with CcmCE
Locus tag: Shewmr4_0227
Name: ccmE
Funciton: cytochrome c-type biogenesis protein CcmE, heme chaperone
ccmA-ccmB-ccmC-ccmD-ccmE -222 4.2 TTTTGTGATTAGAATCTCAGCA Shewmr4_0231
Shewanella sp MR-7
Position: -222
Score: 3.91053
Sequence: TTTTGTGATTAGAATCTCAGCG
Locus tag: Shewmr7_0226
Name: ccmA
Funciton: ABC transporter involved in cytochrome c biogenesis, ATPase component CcmA
Locus tag: Shewmr7_0225
Name: ccmB
Funciton: ABC transporter involved in cytochrome c biogenesis, CcmB subunit
Locus tag: Shewmr7_0224
Name: ccmC
Funciton: cytochrome c-type biogenesis protein CcmC, putative heme lyase for CcmE
Locus tag: Shewmr7_0223
Name: ccmD
Funciton: cytochrome c-type biogenesis protein CcmD, interacts with CcmCE
Locus tag: Shewmr7_0222
Name: ccmE
Funciton: cytochrome c-type biogenesis protein CcmE, heme chaperone
ccmA-ccmB-ccmC-ccmD-ccmE -222 3.9 TTTTGTGATTAGAATCTCAGCG Shewmr7_0226
Shewanella sp W3-18-1
Position: -213
Score: 3.91053
Sequence: TTTTGTGATTAGAATCTCAGCG
Locus tag: Sputw3181_0188
Name: ccmA
Funciton: ABC transporter involved in cytochrome c biogenesis, ATPase component CcmA
Locus tag: Sputw3181_0187
Name: ccmB
Funciton: ABC transporter involved in cytochrome c biogenesis, CcmB subunit
Locus tag: Sputw3181_0186
Name: ccmC
Funciton: cytochrome c-type biogenesis protein CcmC, putative heme lyase for CcmE
Locus tag: Sputw3181_0185
Name: ccmD
Funciton: cytochrome c-type biogenesis protein CcmD, interacts with CcmCE
Locus tag: Sputw3181_0184
Name: ccmE
Funciton: cytochrome c-type biogenesis protein CcmE, heme chaperone
ccmA-ccmB-ccmC-ccmD-ccmE -213 3.9 TTTTGTGATTAGAATCTCAGCG Sputw3181_0188
Shewanella woodyi ATCC 51908
Position: -224
Score: 4.15542
Sequence: TTTTATGACTTTAATCAAAGTA
Locus tag: Swoo_4659
Name: ccmA
Funciton: ABC transporter involved in cytochrome c biogenesis, ATPase component CcmA
Locus tag: Swoo_4660
Name: ccmB
Funciton: ABC transporter involved in cytochrome c biogenesis, CcmB subunit
Locus tag: Swoo_4661
Name: ccmC
Funciton: cytochrome c-type biogenesis protein CcmC, putative heme lyase for CcmE
Locus tag: Swoo_4662
Name: ccmD
Funciton: cytochrome c-type biogenesis protein CcmD, interacts with CcmCE
Locus tag: Swoo_4663
Name: ccmE
Funciton: cytochrome c-type biogenesis protein CcmE, heme chaperone
ccmA-ccmB-ccmC-ccmD-ccmE -224 4.2 TTTTATGACTTTAATCAAAGTA Swoo_4659
© 2009-2020 RegPrecise