Orthologous regulated operons containing amt1 gene

Properties
Regulog:	AmtR - Corynebacteriaceae
Regulator type:	Transcription factor
Regulator family:	TetR
Regulation mode:	repressor
Biological process:	Nitrogen metabolism
Effector:	GlnK-AMP, signal transduction protein
Phylum:	Actinobacteria

Built upon 42 sites [see more]

Orthologous operons
Operon	Position	Score	Sequence	Locus Tag of the First Gene
Corynebacterium efficiens YS-314
Position: -102 Score: 5.63034 Sequence: ATTATCGGTCGATCTATAGATAAA Locus tag: CE0715 Name: amt1 Funciton: Urea carboxylase-related aminomethyltransferase (EC 2.1.2.10) Locus tag: CE0714 Name: amt2 Funciton: Urea carboxylase-related aminomethyltransferase (EC 2.1.2.10) Locus tag: CE0713 Name: ucaA Funciton: Urea carboxylase (EC 6.3.4.6)
amt1-amt2-ucaA	-102	5.6	ATTATCGGTCGATCTATAGATAAA	CE0715

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --