Orthologous regulated operons containing cg2181 gene

Properties
Regulog:	AmtR - Corynebacteriaceae
Regulator type:	Transcription factor
Regulator family:	TetR
Regulation mode:	repressor
Biological process:	Nitrogen metabolism
Effector:	GlnK-AMP, signal transduction protein
Phylum:	Actinobacteria

Built upon 42 sites [see more]

Orthologous operons
Operon	Position	Score	Sequence	Locus Tag of the First Gene
Corynebacterium diphtheriae NCTC 13129
Position: -162 Score: 4.01277 Sequence: TAAAACTATTATTTGATAGTTTTA Locus tag: DIP0956 Name: cg2181 Funciton: Predicted ABC transporter, substrate-binding protein Locus tag: DIP0957 Name: cg2182 Funciton: Predicted ABC transporter, permease protein 1 Locus tag: DIP0958 Name: cg2183 Funciton: Predicted ABC transporter, permease protein 2 Locus tag: DIP0959 Name: cg2184 Funciton: Predicted ABC transporter, ATP-binding protein
cg2181-cg2182-cg2183-cg2184	-162	4	TAAAACTATTATTTGATAGTTTTA	DIP0956
Corynebacterium glutamicum ATCC 13032
Position: -218 Score: 5.73849 Sequence: AATTTCTATCAAACTATAGAAAGA Locus tag: cg2181 Name: cg2181 Funciton: Predicted ABC transporter, substrate-binding protein Locus tag: cg2182 Name: cg2182 Funciton: Predicted ABC transporter, permease protein 1 Locus tag: cg2183 Name: cg2183 Funciton: Predicted ABC transporter, permease protein 2 Locus tag: cg2184 Name: cg2184 Funciton: Predicted ABC transporter, ATP-binding protein
cg2181-cg2182-cg2183-cg2184	-218	5.7	AATTTCTATCAAACTATAGAAAGA	cg2181

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --