Orthologous regulated operons containing gluD gene

Properties
Regulog:	AmtR - Corynebacteriaceae
Regulator type:	Transcription factor
Regulator family:	TetR
Regulation mode:	repressor
Biological process:	Nitrogen metabolism
Effector:	GlnK-AMP, signal transduction protein
Phylum:	Actinobacteria

Built upon 42 sites [see more]

Orthologous operons
Operon	Position	Score	Sequence	Locus Tag of the First Gene
Corynebacterium efficiens YS-314
Position: -110 Score: 4.90032 Sequence: TTTACCTATTGAGCTATTGATAAA Locus tag: CE1844 Name: gluA Funciton: Glutamate ABC transporter, ATP-binding protein Locus tag: CE1845 Name: gluB Funciton: Glutamate ABC transporter, substrate-binding protein Locus tag: CE1846 Name: gluC Funciton: Glutamate ABC transporter, permease protein 1 Locus tag: CE1847 Name: gluD Funciton: Glutamate ABC transporter, permease protein 2
gluA-gluB-gluC-gluD	-110	4.9	TTTACCTATTGAGCTATTGATAAA	CE1844
Corynebacterium glutamicum ATCC 13032
Position: -193 Score: 5.23548 Sequence: AATATCTATCATGTGATAGGTAAA Locus tag: cg2136 Name: gluA Funciton: Glutamate ABC transporter, ATP-binding protein Locus tag: cg2137 Name: gluB Funciton: Glutamate ABC transporter, substrate-binding protein Locus tag: cg2138 Name: gluC Funciton: Glutamate ABC transporter, permease protein 1 Locus tag: cg2139 Name: gluD Funciton: Glutamate ABC transporter, permease protein 2
gluA-gluB-gluC-gluD	-193	5.2	AATATCTATCATGTGATAGGTAAA	cg2136

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --