Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Orthologous regulated operons containing gluC gene

Properties
Regulog: AmtR - Corynebacteriaceae
Regulator type: Transcription factor
Regulator family: TetR
Regulation mode: repressor
Biological process: Nitrogen metabolism
Effector: GlnK-AMP, signal transduction protein
Phylum: Actinobacteria
Built upon 42 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Corynebacterium efficiens YS-314
Position: -110
Score: 4.90032
Sequence: TTTACCTATTGAGCTATTGATAAA
Locus tag: CE1844
Name: gluA
Funciton: Glutamate ABC transporter, ATP-binding protein
Locus tag: CE1845
Name: gluB
Funciton: Glutamate ABC transporter, substrate-binding protein
Locus tag: CE1846
Name: gluC
Funciton: Glutamate ABC transporter, permease protein 1
Locus tag: CE1847
Name: gluD
Funciton: Glutamate ABC transporter, permease protein 2
gluA-gluB-gluC-gluD -110 4.9 TTTACCTATTGAGCTATTGATAAA CE1844
Corynebacterium glutamicum ATCC 13032
Position: -193
Score: 5.23548
Sequence: AATATCTATCATGTGATAGGTAAA
Locus tag: cg2136
Name: gluA
Funciton: Glutamate ABC transporter, ATP-binding protein
Locus tag: cg2137
Name: gluB
Funciton: Glutamate ABC transporter, substrate-binding protein
Locus tag: cg2138
Name: gluC
Funciton: Glutamate ABC transporter, permease protein 1
Locus tag: cg2139
Name: gluD
Funciton: Glutamate ABC transporter, permease protein 2
gluA-gluB-gluC-gluD -193 5.2 AATATCTATCATGTGATAGGTAAA cg2136