Orthologous regulated operons containing urtD gene

Properties
Regulog:	AmtR - Corynebacteriaceae
Regulator type:	Transcription factor
Regulator family:	TetR
Regulation mode:	repressor
Biological process:	Nitrogen metabolism
Effector:	GlnK-AMP, signal transduction protein
Phylum:	Actinobacteria

Built upon 42 sites [see more]

Orthologous operons
Operon	Position	Score	Sequence	Locus Tag of the First Gene
Corynebacterium glutamicum ATCC 13032
Position: -68 Score: 5.06896 Sequence: ACTACCTATAGGCTGACAGAAACT Position: -42 Score: 5.50602 Sequence: AAAAACTATAGAGCTATAGAAACT Locus tag: cg1061 Name: urtA Funciton: Urea ABC transporter, substrate-binding protein Locus tag: cg1062 Name: urtB Funciton: Urea ABC transporter, permease protein 1 Locus tag: cg1064 Name: urtC Funciton: Urea ABC transporter, permease protein 2 Locus tag: cg1065 Name: urtD Funciton: Urea ABC transporter, ATP-binding protein 1 Locus tag: cg1066 Name: urtE Funciton: Urea ABC transporter, ATP-binding protein 2
urtA-urtB-urtC-urtD-urtE	-68	5.1	ACTACCTATAGGCTGACAGAAACT	cg1061
	-42	5.5	AAAAACTATAGAGCTATAGAAACT

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --