Orthologous regulated operons containing Smlt1156 gene

Properties
Regulog:	IscR - Xanthomonadales
Regulator type:	Transcription factor
Regulator family:	Rrf2
Regulation mode:	activator (repressor)
Biological process:	Iron-sulfur cluster biogenesis
Effector:	Iron-sulfur cluster redox state
Phylum:	Proteobacteria

Built upon 4 sites [see more]

Orthologous operons
Operon	Position	Score	Sequence	Locus Tag of the First Gene
Stenotrophomonas maltophilia K279a
Position: -44 Score: 8.3157 Sequence: AAAGCGTACAATTTCAGTCCGCTTT Locus tag: Smlt1158 Name: iscR Funciton: Iron-sulfur cluster regulator IscR Locus tag: Smlt1157 Name: sufB Funciton: Iron-sulfur cluster assembly protein SufB Locus tag: Smlt1156 Name: null Funciton: hypothetical protein Locus tag: Smlt1155 Name: sufC Funciton: Iron-sulfur cluster assembly ATPase protein SufC Locus tag: Smlt1154 Name: sufD Funciton: Iron-sulfur cluster assembly protein SufD Locus tag: Smlt1153 Name: sufS Funciton: Cysteine desulfurase (EC 2.8.1.7), SufS subfamily
iscR-sufB-Smlt1156-sufC-sufD-sufS	-44	8.3	AAAGCGTACAATTTCAGTCCGCTTT	Smlt1158

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --