Orthologous regulated operons containing Smlt1156 gene
| Regulog: | IscR - Xanthomonadales |
| Regulator type: | Transcription factor |
| Regulator family: | Rrf2 |
| Regulation mode: | activator (repressor) |
| Biological process: | Iron-sulfur cluster biogenesis |
| Effector: | Iron-sulfur cluster redox state |
| Phylum: | Proteobacteria |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Stenotrophomonas maltophilia K279a | ||||
|
Position: -44
Score: 8.3157 Sequence: AAAGCGTACAATTTCAGTCCGCTTT
Locus tag: Smlt1158
Name: iscR Funciton: Iron-sulfur cluster regulator IscR
Locus tag: Smlt1157
Name: sufB Funciton: Iron-sulfur cluster assembly protein SufB
Locus tag: Smlt1156
Name: null Funciton: hypothetical protein
Locus tag: Smlt1155
Name: sufC Funciton: Iron-sulfur cluster assembly ATPase protein SufC
Locus tag: Smlt1154
Name: sufD Funciton: Iron-sulfur cluster assembly protein SufD
Locus tag: Smlt1153
Name: sufS Funciton: Cysteine desulfurase (EC 2.8.1.7), SufS subfamily |
||||
| iscR-sufB-Smlt1156-sufC-sufD-sufS | -44 | 8.3 | AAAGCGTACAATTTCAGTCCGCTTT | Smlt1158 |