Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Orthologous regulated operons containing znuB gene

Properties
Regulog: Zur2 - Comamonadaceae
Regulator type: Transcription factor
Regulator family: FUR
Regulation mode: repressor
Biological process: Zinc homeostasis
Effector: Zinc ion, (Zn2+)
Phylum: Proteobacteria
Built upon 3 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Leptothrix cholodnii SP-6
Position: -111
Score: 5.90981
Sequence: CGTATCATTTGACGCATGAAGGC
Locus tag: Lcho_3564
Name: zur2
Funciton: Zinc uptake regulation protein Zur
Locus tag: Lcho_3563
Name: Lcho_3563
Funciton: Hypothetical protein
Locus tag: Lcho_3562
Name: znuC
Funciton: Zinc ABC transporter, ATP-binding protein ZnuC
Locus tag: Lcho_3561
Name: znuB
Funciton: Zinc ABC transporter, inner membrane permease protein ZnuB
Locus tag: Lcho_3560
Name: znuA
Funciton: Zinc ABC transporter, periplasmic-binding protein ZnuA
zur2-Lcho_3563-znuC-znuB-znuA -111 5.9 CGTATCATTTGACGCATGAAGGC Lcho_3564
Verminephrobacter eiseniae EF01-2
Position: -143
Score: 6.11376
Sequence: ACTATCATCTGGCCCATGAAAAA
Locus tag: Veis_3390
Name: znuC
Funciton: Zinc ABC transporter, ATP-binding protein ZnuC
Locus tag: Veis_3391
Name: znuB
Funciton: Zinc ABC transporter, inner membrane permease protein ZnuB
Locus tag: Veis_3392
Name: znuA
Funciton: Zinc ABC transporter, periplasmic-binding protein ZnuA
znuC-znuB-znuA -143 6.1 ACTATCATCTGGCCCATGAAAAA Veis_3390