Orthologous regulated operons containing omr gene

Properties
Regulog:	Zur - Comamonadaceae
Regulator type:	Transcription factor
Regulator family:	FUR
Regulation mode:	repressor
Biological process:	Zinc homeostasis
Effector:	Zinc ion, (Zn2+)
Phylum:	Proteobacteria

Built upon 11 sites [see more]

Orthologous operons
Operon	Position	Score	Sequence	Locus Tag of the First Gene
Acidovorax avenae subsp. citrulli AAC00-1
Position: -50 Score: 6.83864 Sequence: ATAATGCAACACGATTGCATTAA Locus tag: Aave_2813 Name: zur Funciton: Zinc uptake regulation protein Zur Locus tag: Aave_2812 Name: COG2884 Funciton: ABC transporter-related protein Locus tag: Aave_2811 Name: COG4591 Funciton: Predicted ABC transport system, permease protein Locus tag: Aave_2810 Name: Aave_2810 Funciton: Conserved hypothetical protein Locus tag: Aave_2809 Name: PF11736 Funciton: Lipoprotein, putative Locus tag: Aave_2808 Name: COG4531 Funciton: Predicted zinc-binding periplasmic protein Locus tag: Aave_2807 Name: omr Funciton: Predicted zinc-regulated TonB-dependent outer membrane transporter
zur-COG2884-COG4591-Aave_2810-PF11736-COG4531-omr	-50	6.8	ATAATGCAACACGATTGCATTAA	Aave_2813
Delftia acidovorans SPH-1
Position: -72 Score: 6.85897 Sequence: ATAATGCAACCCGGTTGCGATAA Locus tag: Daci_3951 Name: zur Funciton: Zinc uptake regulation protein Zur Locus tag: Daci_3950 Name: Aave_2810 Funciton: Conserved hypothetical protein Locus tag: Daci_3949 Name: COG4531 Funciton: Predicted zinc-binding periplasmic protein Locus tag: Daci_3948 Name: omr Funciton: Predicted zinc-regulated TonB-dependent outer membrane transporter
zur-Aave_2810-COG4531-omr	-72	6.9	ATAATGCAACCCGGTTGCGATAA	Daci_3951
Polaromonas sp. JS666
Position: 27 Score: 6.95651 Sequence: ATAATGCAACTAGATTGCGTTAT Locus tag: Bpro_1677 Name: zur Funciton: Zinc uptake regulation protein Zur Locus tag: Bpro_1678 Name: COG2884 Funciton: ABC transporter-related protein Locus tag: Bpro_1679 Name: COG4591 Funciton: Predicted ABC transport system, permease protein Locus tag: Bpro_1680 Name: Aave_2810 Funciton: Conserved hypothetical protein Locus tag: Bpro_1681 Name: PF11736 Funciton: Lipoprotein, putative Locus tag: Bpro_1682 Name: COG4531 Funciton: Predicted zinc-binding periplasmic protein Locus tag: Bpro_1683 Name: omr Funciton: Predicted zinc-regulated TonB-dependent outer membrane transporter
zur-COG2884-COG4591-Aave_2810-PF11736-COG4531-omr	27	7	ATAATGCAACTAGATTGCGTTAT	Bpro_1677