Orthologous regulated operons containing Nmul_A2511 gene

Properties
Regulog:	Zur - Various betaproteobacteria
Regulator type:	Transcription factor
Regulator family:	FUR
Regulation mode:	repressor
Biological process:	Zinc homeostasis
Effector:	Zinc ion, (Zn2+)
Phylum:	Proteobacteria

Built upon 10 sites [see more]

Orthologous operons
Operon	Position	Score	Sequence	Locus Tag of the First Gene
Nitrosospira multiformis ATCC 25196
Position: 145 Score: 4.93381 Sequence: TAAATGCAACTCTGTTGCAAACT Locus tag: Nmul_A2512 Name: null Funciton: ferric uptake regulator, FUR family Locus tag: Nmul_A2511 Name: null Funciton: hypothetical protein Locus tag: Nmul_A2510 Name: omr2 Funciton: Predicted zinc-related TonB-dependent outer membrane transporter
Nmul_A2512-Nmul_A2511-omr2	145	4.9	TAAATGCAACTCTGTTGCAAACT	Nmul_A2512

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --