Orthologous regulated operons containing Nmul_A2511 gene
| Regulog: | Zur - Various betaproteobacteria |
| Regulator type: | Transcription factor |
| Regulator family: | FUR |
| Regulation mode: | repressor |
| Biological process: | Zinc homeostasis |
| Effector: | Zinc ion, (Zn2+) |
| Phylum: | Proteobacteria |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Nitrosospira multiformis ATCC 25196 | ||||
|
Position: 145
Score: 4.93381 Sequence: TAAATGCAACTCTGTTGCAAACT
Locus tag: Nmul_A2512
Name: null Funciton: ferric uptake regulator, FUR family
Locus tag: Nmul_A2511
Name: null Funciton: hypothetical protein
Locus tag: Nmul_A2510
Name: omr2 Funciton: Predicted zinc-related TonB-dependent outer membrane transporter |
||||
| Nmul_A2512-Nmul_A2511-omr2 | 145 | 4.9 | TAAATGCAACTCTGTTGCAAACT | Nmul_A2512 |