Orthologous regulated operons containing PF11736 gene
| Regulog: | Zur - Various betaproteobacteria |
| Regulator type: | Transcription factor |
| Regulator family: | FUR |
| Regulation mode: | repressor |
| Biological process: | Zinc homeostasis |
| Effector: | Zinc ion, (Zn2+) |
| Phylum: | Proteobacteria |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Methylobacillus flagellatus KT | ||||
|
Position: -11
Score: 6.39724 Sequence: AATATGCCACAATGTTGCATTAC
Locus tag: Mfla_0708
Name: omr Funciton: Predicted zinc-related TonB-dependent outer membrane transporter
Locus tag: Mfla_0707
Name: zip Funciton: Zinc transporter, ZIP family
Locus tag: Mfla_0706
Name: PF10986 Funciton: Predicted ABC transport system, substrate-binding protein
Locus tag: Mfla_0705
Name: COG1124 Funciton: Predicted ABC transport system, ATP-binding protein
Locus tag: Mfla_0704
Name: COG0577 Funciton: Predicted ABC transport system, permease protein
Locus tag: Mfla_0703
Name: PF11736 Funciton: Lipoprotein, putative |
||||
| omr-zip-PF10986-COG1124-COG0577-PF11736 | -11 | 6.4 | AATATGCCACAATGTTGCATTAC | Mfla_0708 |
| Thauera sp. MZ1T | ||||
|
Position: -99
Score: 6.36925 Sequence: TTGATGCAACATTGTAGCATTAG
Locus tag: Tmz1t_3495
Name: PF10986 Funciton: Predicted ABC transport system, substrate-binding protein
Locus tag: Tmz1t_3494
Name: COG1124 Funciton: Predicted ABC transport system, ATP-binding protein
Locus tag: Tmz1t_3493
Name: COG0577 Funciton: Predicted ABC transport system, permease protein
Locus tag: Tmz1t_3492
Name: PF11736 Funciton: Lipoprotein, putative |
||||
| PF10986-COG1124-COG0577-PF11736 | -99 | 6.4 | TTGATGCAACATTGTAGCATTAG | Tmz1t_3495 |