Orthologous regulated operons containing zip gene

Properties
Regulog:	Zur - Various betaproteobacteria
Regulator type:	Transcription factor
Regulator family:	FUR
Regulation mode:	repressor
Biological process:	Zinc homeostasis
Effector:	Zinc ion, (Zn2+)
Phylum:	Proteobacteria

Built upon 10 sites [see more]

Orthologous operons
Operon	Position	Score	Sequence	Locus Tag of the First Gene
Methylobacillus flagellatus KT
Position: -11 Score: 6.39724 Sequence: AATATGCCACAATGTTGCATTAC Locus tag: Mfla_0708 Name: omr Funciton: Predicted zinc-related TonB-dependent outer membrane transporter Locus tag: Mfla_0707 Name: zip Funciton: Zinc transporter, ZIP family Locus tag: Mfla_0706 Name: PF10986 Funciton: Predicted ABC transport system, substrate-binding protein Locus tag: Mfla_0705 Name: COG1124 Funciton: Predicted ABC transport system, ATP-binding protein Locus tag: Mfla_0704 Name: COG0577 Funciton: Predicted ABC transport system, permease protein Locus tag: Mfla_0703 Name: PF11736 Funciton: Lipoprotein, putative
omr-zip-PF10986-COG1124-COG0577-PF11736	-11	6.4	AATATGCCACAATGTTGCATTAC	Mfla_0708

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --