Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Orthologous regulated operons containing Tmz1t_3497 gene

Properties
Regulog: Zur - Various betaproteobacteria
Regulator type: Transcription factor
Regulator family: FUR
Regulation mode: repressor
Biological process: Zinc homeostasis
Effector: Zinc ion, (Zn2+)
Phylum: Proteobacteria
Built upon 10 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Thauera sp. MZ1T
Position: -81
Score: 6.50627
Sequence: CTAATGCTACAATGTTGCATCAA
Locus tag: Tmz1t_3496
Name: zur
Funciton: Zinc uptake regulation protein Zur
Locus tag: Tmz1t_3497
Name: Tmz1t_3497
Funciton: Hypothetical protein
Locus tag: Tmz1t_3498
Name: znuC
Funciton: Zinc ABC transporter, ATP-binding protein ZnuC
Locus tag: Tmz1t_3499
Name: znuB
Funciton: Zinc ABC transporter, inner membrane permease protein ZnuB
Locus tag: Tmz1t_3500
Name: znuA
Funciton: Zinc ABC transporter, periplasmic-binding protein ZnuA
zur-Tmz1t_3497-znuC-znuB-znuA -81 6.5 CTAATGCTACAATGTTGCATCAA Tmz1t_3496