Orthologous regulated operons containing ebA1811 gene
| Regulog: | Zur - Various betaproteobacteria |
| Regulator type: | Transcription factor |
| Regulator family: | FUR |
| Regulation mode: | repressor |
| Biological process: | Zinc homeostasis |
| Effector: | Zinc ion, (Zn2+) |
| Phylum: | Proteobacteria |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Azoarcus sp. EbN1 | ||||
|
Position: 2
Score: 6.76534 Sequence: GAAATGCTACAATGTTGCATTAG
Locus tag: ebA1809
Name: zur Funciton: Zinc uptake regulation protein Zur
Locus tag: ebA1811
Name: ebA1811 Funciton: Hypothetical protein
Locus tag: ebA1812
Name: znuC Funciton: Zinc ABC transporter, ATP-binding protein ZnuC
Locus tag: ebA1813
Name: znuB Funciton: Zinc ABC transporter, inner membrane permease protein ZnuB
Locus tag: ebA1814
Name: znuA Funciton: Zinc ABC transporter, periplasmic-binding protein ZnuA |
||||
| zur-ebA1811-znuC-znuB-znuA | 2 | 6.8 | GAAATGCTACAATGTTGCATTAG | ebA1809 |