Orthologous regulated operons containing exbB gene
Regulog: | Zur - Burkholderia |
Regulator type: | Transcription factor |
Regulator family: | FUR |
Regulation mode: | repressor |
Biological process: | Zinc homeostasis |
Effector: | Zinc ion, (Zn2+) |
Phylum: | Proteobacteria |

Operon | Position | Score | Sequence | Locus Tag of the First Gene |
---|---|---|---|---|
Burkholderia xenovorans LB400 | ||||
Position: -165
Score: 4.93616 Sequence: TGAATGTAATGATATAACATTCC
Locus tag: Bxe_B0900
Name: omr2 Funciton: Predicted zinc-related TonB-dependent outer membrane transporter
Locus tag: Bxe_B0899
Name: exbB Funciton: Biopolymer transport protein, MotA/TolQ/ExbB proton channel family protein
Locus tag: Bxe_B0898
Name: exbD Funciton: Biopolymer transport protein ExbD/TolR
Locus tag: Bxe_B0897
Name: tonB Funciton: Biopolymer transport protein, TonB protein |
||||
omr2-exbB-exbD-tonB | -165 | 4.9 | TGAATGTAATGATATAACATTCC | Bxe_B0900 |