Orthologous regulated operons containing livM1 gene
Regulog: | PaaR - Rhodobacterales |
Regulator type: | Transcription factor |
Regulator family: | TetR |
Regulation mode: | repressor |
Biological process: | Phenylacetic acid degradation |
Effector: | Phenylacetyl-CoA |
Phylum: | Alphaproteobacteria |

Operon | Position | Score | Sequence | Locus Tag of the First Gene |
---|---|---|---|---|
Paracoccus denitrificans PD1222 | ||||
Position: -20
Score: 6.57811 Sequence: ATAAACCGACCGGCCGGTCAAT
Locus tag: paaZ2
Name: paaZ2 Funciton: Aldehyde dehydrogenase (EC 1.2.1.3), PaaZ
Locus tag: Pden_4797
Name: livK Funciton: Putative branched-chain amino acid ABC transporter, substrate-binding component
Locus tag: Pden_4796
Name: livH Funciton: Putative branched-chain amino acid ABC transporter, permease component
Locus tag: Pden_4795
Name: livF Funciton: Putative branched-chain amino acid ABC transporter, permease component 2
Locus tag: Pden_4794
Name: livM1 Funciton: utative branched-chain amino acid ABC transporter, ATPase component 1
Locus tag: Pden_4793
Name: livM2 Funciton: utative branched-chain amino acid ABC transporter, ATPase component 2
Locus tag: Pden_4792
Name: fadB Funciton: Enoyl-CoA hydratase (EC 4.2.1.17) |
||||
paaZ2-livK-livH-livF-livM1-livM2-fadB | -20 | 6.6 | ATAAACCGACCGGCCGGTCAAT | paaZ2 |