Orthologous regulated operons containing paaD gene
Regulog: | PaaR - Rhodobacterales |
Regulator type: | Transcription factor |
Regulator family: | TetR |
Regulation mode: | repressor |
Biological process: | Phenylacetic acid degradation |
Effector: | Phenylacetyl-CoA |
Phylum: | Alphaproteobacteria |

Operon | Position | Score | Sequence | Locus Tag of the First Gene |
---|---|---|---|---|
Paracoccus denitrificans PD1222 | ||||
Position: -61
Score: 6.02649 Sequence: ATTGACCAATCGGTCGGTGAAT
Locus tag: Pden_4811
Name: paaJ Funciton: Beta-ketoadipyl CoA thiolase (EC 2.3.1.-)
Locus tag: Pden_4810
Name: paaA Funciton: Phenylacetate-CoA oxygenase, PaaA subunit
Locus tag: Pden_4809
Name: paaB Funciton: Phenylacetate-CoA oxygenase, PaaB subunit
Locus tag: Pden_4808
Name: paaC Funciton: Phenylacetate-CoA oxygenase, PaaC subunit
Locus tag: Pden_4807
Name: paaD Funciton: Phenylacetate-CoA oxygenase, PaaD subunit
Locus tag: Pden_4806
Name: paaE Funciton: Probable phenylacetic acid degradation NADH oxidoreductase paaE (EC 1.-.-.-)
Locus tag: Pden_4805
Name: Pden_4805 Funciton: Phenylacetic acid catabolic protein
Locus tag: Pden_4804
Name: paaZ Funciton: Aldehyde dehydrogenase (EC 1.2.1.3), PaaZ |
||||
paaJ-paaA-paaB-paaC-paaD-paaE-Pden_4805-paaZ | -61 | 6 | ATTGACCAATCGGTCGGTGAAT | Pden_4811 |