Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Orthologous regulated operons containing NGR_c26140 gene

Properties
Regulog: PaaR - Rhizobiales
Regulator type: Transcription factor
Regulator family: TetR
Regulation mode: repressor
Biological process: Phenylacetic acid degradation
Effector: Phenylacetyl-CoA
Phylum: Alphaproteobacteria
Built upon 14 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Rhizobium sp. NGR234
Position: -53
Score: 5.72292
Sequence: TCTGACCGATCGGTCGGTTAAT
Locus tag: NGR_c26200
Name: blr2890
Funciton: putative beta-ketoadipyl CoA thiolase
Locus tag: NGR_c26190
Name: paaA
Funciton: Phenylacetate-CoA oxygenase, PaaA subunit
Locus tag: NGR_c26180
Name: paaB
Funciton: Phenylacetate-CoA oxygenase, PaaB subunit
Locus tag: NGR_c26170
Name: paaC
Funciton: Phenylacetate-CoA oxygenase, PaaC subunit
Locus tag: NGR_c26160
Name: paaD
Funciton: Phenylacetate-CoA oxygenase, PaaD subunit
Locus tag: NGR_c26150
Name: paaE
Funciton: Probable phenylacetic acid degradation NADH oxidoreductase paaE (EC 1.-.-.-)
Locus tag: NGR_c26140
Name: null
Funciton: ring-oxidation complex protein 1 in the phenylacetic acid catabolism pathway
Locus tag: NGR_c26130
Name: paaZ
Funciton: Aldehyde dehydrogenase (EC 1.2.1.3), PaaZ
blr2890-paaA-paaB-paaC-paaD-paaE-NGR_c26140-paaZ -53 5.7 TCTGACCGATCGGTCGGTTAAT NGR_c26200