Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Orthologous regulated operons containing fadB gene

Properties
Regulog: PaaR - Rhizobiales
Regulator type: Transcription factor
Regulator family: TetR
Regulation mode: repressor
Biological process: Phenylacetic acid degradation
Effector: Phenylacetyl-CoA
Phylum: Alphaproteobacteria
Built upon 14 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Xanthobacter autotrophicus Py2
Position: -166
Score: 6.21572
Sequence: ATTAACCGATCGATCGGTTAAT
Locus tag: Xaut_0904
Name: paaZ
Funciton: Aldehyde dehydrogenase (EC 1.2.1.3), PaaZ
Locus tag: Xaut_0905
Name: paaJ
Funciton: Beta-ketoadipyl CoA thiolase (EC 2.3.1.-)
Locus tag: Xaut_0906
Name: fadB
Funciton: 3-hydroxyacyl-CoA dehydrogenase NAD-binding
Locus tag: Xaut_0907
Name: paaZ
Funciton: Aldehyde dehydrogenase (EC 1.2.1.3), PaaZ
paaZ-paaJ-fadB-paaZ -166 6.2 ATTAACCGATCGATCGGTTAAT Xaut_0904