Orthologous regulated operons containing paaF gene

Properties
Regulog:	PaaR - Rhizobiales
Regulator type:	Transcription factor
Regulator family:	TetR
Regulation mode:	repressor
Biological process:	Phenylacetic acid degradation
Effector:	Phenylacetyl-CoA
Phylum:	Alphaproteobacteria

Built upon 14 sites [see more]

Orthologous operons
Operon	Position	Score	Sequence	Locus Tag of the First Gene
Rhizobium sp. NGR234
Position: -70 Score: 6.46543 Sequence: ATTGACTGACCGGTCGGTTTAT Locus tag: NGR_c26090 Name: paaF Funciton: Enoyl-CoA hydratase (EC 4.2.1.17) Locus tag: NGR_c26100 Name: paaY Funciton: thioesterase superfamily protein Locus tag: NGR_c26110 Name: paaK Funciton: Phenylacetate-coenzyme A ligase (EC 6.2.1.30) Locus tag: NGR_c26120 Name: paaR Funciton: Transcriptional regulator of phenylacetic acid degradation, TetR family
paaF-paaY-paaK-paaR	-70	6.5	ATTGACTGACCGGTCGGTTTAT	NGR_c26090
Xanthobacter autotrophicus Py2
Position: -60 Score: 6.21572 Sequence: ATTAACCGATCGATCGGTTAAT Locus tag: Xaut_0903 Name: paaF Funciton: Enoyl-CoA hydratase (EC 4.2.1.17) Locus tag: Xaut_0902 Name: paaY Funciton: thioesterase superfamily protein Locus tag: Xaut_0901 Name: paaK Funciton: Phenylacetate-coenzyme A ligase (EC 6.2.1.30)
paaF-paaY-paaK	-60	6.2	ATTAACCGATCGATCGGTTAAT	Xaut_0903

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --