Orthologous regulated operons containing blr2898 gene

Properties
Regulog:	PaaR - Rhizobiales
Regulator type:	Transcription factor
Regulator family:	TetR
Regulation mode:	repressor
Biological process:	Phenylacetic acid degradation
Effector:	Phenylacetyl-CoA
Phylum:	Alphaproteobacteria

Built upon 14 sites [see more]

Orthologous operons
Operon	Position	Score	Sequence	Locus Tag of the First Gene
Rhodopseudomonas palustris CGA009
Position: -108 Score: 5.68053 Sequence: ATTGAACGATCGGTCAGTCAAT Locus tag: RPA1725 Name: paaZ Funciton: Aldehyde dehydrogenase (EC 1.2.1.3), PaaZ Locus tag: RPA1726 Name: blr2898 Funciton: putative zinc binding dehydrogenase
paaZ-blr2898	-108	5.7	ATTGAACGATCGGTCAGTCAAT	RPA1725

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --