Orthologous regulated operons containing livM2 gene

Properties
Regulog:	PaaR - Rhizobiales
Regulator type:	Transcription factor
Regulator family:	TetR
Regulation mode:	repressor
Biological process:	Phenylacetic acid degradation
Effector:	Phenylacetyl-CoA
Phylum:	Alphaproteobacteria

Built upon 14 sites [see more]

Orthologous operons
Operon	Position	Score	Sequence	Locus Tag of the First Gene
Rhodopseudomonas palustris CGA009
Position: -144 Score: 6.31073 Sequence: ATTGACCGACCGTTCGGTTAAG Locus tag: RPA4019 Name: livK Funciton: Putative branched-chain amino acid ABC transporter, substrate-binding component Locus tag: RPA4020 Name: livH Funciton: Putative branched-chain amino acid ABC transporter, permease component Locus tag: RPA4021 Name: livF Funciton: Putative branched-chain amino acid ABC transporter, permease component 2 Locus tag: RPA4022 Name: livM1 Funciton: utative branched-chain amino acid ABC transporter, ATPase component 1 Locus tag: RPA4023 Name: livM2 Funciton: utative branched-chain amino acid ABC transporter, ATPase component 2
livK-livH-livF-livM1-livM2	-144	6.3	ATTGACCGACCGTTCGGTTAAG	RPA4019
Xanthobacter autotrophicus Py2
Position: -175 Score: 5.29137 Sequence: ATTGTCCGTCTGGTCGATCAAT Position: -117 Score: 6.65276 Sequence: ATTGACCATCCGGTCGGTCAAT Locus tag: Xaut_0893 Name: livK Funciton: Putative branched-chain amino acid ABC transporter, substrate-binding component Locus tag: Xaut_0892 Name: livH Funciton: Putative branched-chain amino acid ABC transporter, permease component Locus tag: Xaut_0891 Name: livF Funciton: Putative branched-chain amino acid ABC transporter, permease component 2 Locus tag: Xaut_0890 Name: livM1 Funciton: utative branched-chain amino acid ABC transporter, ATPase component 1 Locus tag: Xaut_0889 Name: livM2 Funciton: utative branched-chain amino acid ABC transporter, ATPase component 2
livK-livH-livF-livM1-livM2	-175	5.3	ATTGTCCGTCTGGTCGATCAAT	Xaut_0893
	-117	6.7	ATTGACCATCCGGTCGGTCAAT