Orthologous regulated operons containing uxuM2 gene
Regulog: | UxuR - Bacillales |
Regulator type: | Transcription factor |
Regulator family: | GntR/Others |
Regulation mode: | repressor |
Biological process: | Glucuronate utilization |
Effector: | Aldotetraouronic acid |
Phylum: | Firmicutes |

Operon | Position | Score | Sequence | Locus Tag of the First Gene |
---|---|---|---|---|
Bacillus clausii KSM-K16 | ||||
Position: -62
Score: 5.7713 Sequence: CTACCATATTTGTATGGTAG
Locus tag: ABC4047
Name: uxuR2 Funciton: Transcriptional regulator of glucuronate utilization, GntR family
Locus tag: ABC4046
Name: uxuP2 Funciton: Predicted glucuronate TRAP-type transporter, periplasmic component
Locus tag: ABC4045
Name: uxuQ2 Funciton: Predicted glucuronate TRAP-type transporter, small permease component
Locus tag: ABC4044
Name: uxuM2 Funciton: Predicted glucuronate TRAP-type transporter, large permease component |
||||
uxuR2-uxuP2-uxuQ2-uxuM2 | -62 | 5.8 | CTACCATATTTGTATGGTAG | ABC4047 |