Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Orthologous regulated operons containing uxuR2 gene

Properties
Regulog: UxuR - Bacillales
Regulator type: Transcription factor
Regulator family: GntR/Others
Regulation mode: repressor
Biological process: Glucuronate utilization
Effector: Aldotetraouronic acid
Phylum: Firmicutes
Built upon 7 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Bacillus clausii KSM-K16
Position: -62
Score: 5.7713
Sequence: CTACCATATTTGTATGGTAG
Locus tag: ABC4047
Name: uxuR2
Funciton: Transcriptional regulator of glucuronate utilization, GntR family
Locus tag: ABC4046
Name: uxuP2
Funciton: Predicted glucuronate TRAP-type transporter, periplasmic component
Locus tag: ABC4045
Name: uxuQ2
Funciton: Predicted glucuronate TRAP-type transporter, small permease component
Locus tag: ABC4044
Name: uxuM2
Funciton: Predicted glucuronate TRAP-type transporter, large permease component
uxuR2-uxuP2-uxuQ2-uxuM2 -62 5.8 CTACCATATTTGTATGGTAG ABC4047