Orthologous regulated operons containing BH1064 gene
Regulog: | UxuR - Bacillales |
Regulator type: | Transcription factor |
Regulator family: | GntR/Others |
Regulation mode: | repressor |
Biological process: | Glucuronate utilization |
Effector: | Aldotetraouronic acid |
Phylum: | Firmicutes |

Operon | Position | Score | Sequence | Locus Tag of the First Gene |
---|---|---|---|---|
Bacillus halodurans C-125 | ||||
Position: -186
Score: 6.10062 Sequence: CTACCATACTAGTATGATTA
Locus tag: BH1064
Name: BH1064 Funciton: Putative aldotetraouronic acid ABC transporter, substrate-binding protein
Locus tag: BH1065
Name: BH1065 Funciton: Putative aldotetraouronic acid ABC transporter, permease component
Locus tag: BH1066
Name: BH1066 Funciton: Putative aldotetraouronic acid ABC transporter, permease component
Locus tag: BH1067
Name: uxuB Funciton: D-mannonate oxidoreductase (EC 1.1.1.57)
Locus tag: BH1068
Name: xynB Funciton: Beta-xylosidase |
||||
BH1064-BH1065-BH1066-uxuB-xynB | -186 | 6.1 | CTACCATACTAGTATGATTA | BH1064 |