Orthologous regulated operons containing cg1834 gene
| Regulog: | Cg1831 - Corynebacteriaceae |
| Regulator type: | Transcription factor |
| Regulator family: | ArsR |
| Regulation mode: | repressor |
| Biological process: | Iron homeostasis |
| Effector: | |
| Phylum: | Actinobacteria |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Corynebacterium efficiens YS-314 | ||||
|
Position: -34
Score: 5.94376 Sequence: AGTCAAACGGGTGATTGAGT
Locus tag: CE2677
Name: cg1832 Funciton: Predicted Fe-siderophore ABC transporter, permease protein
Locus tag: CE2676
Name: cg1833 Funciton: Predicted Fe-siderophore ABC transporter, substrate-binding protein
Locus tag: CE2675
Name: cg1834 Funciton: Predicted Fe-siderophore ABC transporter, ATP-binding protein |
||||
| cg1832-cg1833-cg1834 | -34 | 5.9 | AGTCAAACGGGTGATTGAGT | CE2677 |
| Corynebacterium glutamicum ATCC 13032 | ||||
|
Position: -34
Score: 6.52683 Sequence: AGTCAAATGATCATTTGAGT
Locus tag: cg1832
Name: cg1832 Funciton: Predicted Fe-siderophore ABC transporter, permease protein
Locus tag: cg1833
Name: cg1833 Funciton: Predicted Fe-siderophore ABC transporter, substrate-binding protein
Locus tag: cg1834
Name: cg1834 Funciton: Predicted Fe-siderophore ABC transporter, ATP-binding protein |
||||
| cg1832-cg1833-cg1834 | -34 | 6.5 | AGTCAAATGATCATTTGAGT | cg1832 |