Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Orthologous regulated operons containing cg1833 gene

Properties
Regulog: Cg1831 - Corynebacteriaceae
Regulator type: Transcription factor
Regulator family: ArsR
Regulation mode: repressor
Biological process: Iron homeostasis
Effector:
Phylum: Actinobacteria
Built upon 4 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Corynebacterium efficiens YS-314
Position: -34
Score: 5.94376
Sequence: AGTCAAACGGGTGATTGAGT
Locus tag: CE2677
Name: cg1832
Funciton: Predicted Fe-siderophore ABC transporter, permease protein
Locus tag: CE2676
Name: cg1833
Funciton: Predicted Fe-siderophore ABC transporter, substrate-binding protein
Locus tag: CE2675
Name: cg1834
Funciton: Predicted Fe-siderophore ABC transporter, ATP-binding protein
cg1832-cg1833-cg1834 -34 5.9 AGTCAAACGGGTGATTGAGT CE2677
Corynebacterium glutamicum ATCC 13032
Position: -34
Score: 6.52683
Sequence: AGTCAAATGATCATTTGAGT
Locus tag: cg1832
Name: cg1832
Funciton: Predicted Fe-siderophore ABC transporter, permease protein
Locus tag: cg1833
Name: cg1833
Funciton: Predicted Fe-siderophore ABC transporter, substrate-binding protein
Locus tag: cg1834
Name: cg1834
Funciton: Predicted Fe-siderophore ABC transporter, ATP-binding protein
cg1832-cg1833-cg1834 -34 6.5 AGTCAAATGATCATTTGAGT cg1832