Orthologous regulated operons containing sgbT gene
| Regulog: | YiaJ - Enterobacteriales |
| Regulator type: | Transcription factor |
| Regulator family: | IclR |
| Regulation mode: | repressor |
| Biological process: | L-lyxose utilization |
| Effector: | Ascorbate-6-phosphate |
| Phylum: | Proteobacteria/gamma |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Citrobacter koseri ATCC BAA-895 | ||||
|
Position: -72
Score: 6.54484 Sequence: ATTTGAAATCAGATTTCGCAT
Locus tag: CKO_05033
Name: yiaK Funciton: 2,3-diketo-L-gulonate dehydrogenase, NADH-dependent
Locus tag: CKO_05034
Name: yiaL Funciton: hypothetical protein
Locus tag: CKO_05035
Name: cheX Funciton: putative chemotaxis protein
Locus tag: CKO_05036
Name: sgbT Funciton: predicted 3-dehydro-L-gulonate MFS transporter
Locus tag: CKO_05037
Name: lyxK Funciton: L-xylulose kinase |
||||
| yiaK-yiaL-cheX-sgbT-lyxK | -72 | 6.5 | ATTTGAAATCAGATTTCGCAT | CKO_05033 |
| Serratia proteamaculans 568 | ||||
|
Position: -74
Score: 6.09968 Sequence: ATTTGAAATGCAATTCCGCAT
Locus tag: Spro_3933
Name: yiaK Funciton: 2,3-diketo-L-gulonate dehydrogenase, NADH-dependent
Locus tag: Spro_3934
Name: yiaL Funciton: hypothetical protein
Locus tag: Spro_3935
Name: sgbT Funciton: predicted 3-dehydro-L-gulonate MFS transporter
Locus tag: Spro_3936
Name: lyxK Funciton: L-xylulose kinase
Locus tag: Spro_3937
Name: sgbH Funciton: 3-keto-L-gulonate 6-phosphate decarboxylase
Locus tag: Spro_3938
Name: sgbU Funciton: putative 3-hexulose-6-phosphate isomerase
Locus tag: Spro_3939
Name: sgbE Funciton: L-ribulose-5-phosphate 4-epimerase |
||||
| yiaK-yiaL-sgbT-lyxK-sgbH-sgbU-sgbE | -74 | 6.1 | ATTTGAAATGCAATTCCGCAT | Spro_3933 |