Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Orthologous regulated operons containing sgbT gene

Properties
Regulog: YiaJ - Enterobacteriales
Regulator type: Transcription factor
Regulator family: IclR
Regulation mode: repressor
Biological process: L-lyxose utilization
Effector: Ascorbate-6-phosphate
Phylum: Proteobacteria/gamma
Built upon 8 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Citrobacter koseri ATCC BAA-895
Position: -72
Score: 6.54484
Sequence: ATTTGAAATCAGATTTCGCAT
Locus tag: CKO_05033
Name: yiaK
Funciton: 2,3-diketo-L-gulonate dehydrogenase, NADH-dependent
Locus tag: CKO_05034
Name: yiaL
Funciton: hypothetical protein
Locus tag: CKO_05035
Name: cheX
Funciton: putative chemotaxis protein
Locus tag: CKO_05036
Name: sgbT
Funciton: predicted 3-dehydro-L-gulonate MFS transporter
Locus tag: CKO_05037
Name: lyxK
Funciton: L-xylulose kinase
yiaK-yiaL-cheX-sgbT-lyxK -72 6.5 ATTTGAAATCAGATTTCGCAT CKO_05033
Serratia proteamaculans 568
Position: -74
Score: 6.09968
Sequence: ATTTGAAATGCAATTCCGCAT
Locus tag: Spro_3933
Name: yiaK
Funciton: 2,3-diketo-L-gulonate dehydrogenase, NADH-dependent
Locus tag: Spro_3934
Name: yiaL
Funciton: hypothetical protein
Locus tag: Spro_3935
Name: sgbT
Funciton: predicted 3-dehydro-L-gulonate MFS transporter
Locus tag: Spro_3936
Name: lyxK
Funciton: L-xylulose kinase
Locus tag: Spro_3937
Name: sgbH
Funciton: 3-keto-L-gulonate 6-phosphate decarboxylase
Locus tag: Spro_3938
Name: sgbU
Funciton: putative 3-hexulose-6-phosphate isomerase
Locus tag: Spro_3939
Name: sgbE
Funciton: L-ribulose-5-phosphate 4-epimerase
yiaK-yiaL-sgbT-lyxK-sgbH-sgbU-sgbE -74 6.1 ATTTGAAATGCAATTCCGCAT Spro_3933
© 2009-2020 RegPrecise