Orthologous regulated operons containing sgbU gene
Regulog: | YiaJ - Enterobacteriales |
Regulator type: | Transcription factor |
Regulator family: | IclR |
Regulation mode: | repressor |
Biological process: | L-lyxose utilization |
Effector: | Ascorbate-6-phosphate |
Phylum: | Proteobacteria/gamma |

Operon | Position | Score | Sequence | Locus Tag of the First Gene |
---|---|---|---|---|
Escherichia coli str. K-12 substr. MG1655 | ||||
Position: -70
Score: 6.36801 Sequence: ATTTGAAATCAAGTTTCGCAT
Locus tag: b3575
Name: yiaK Funciton: 2,3-diketo-L-gulonate dehydrogenase, NADH-dependent
Locus tag: b3576
Name: yiaL Funciton: hypothetical protein
Locus tag: b3577
Name: yiaM Funciton: predicted 3-dehydro-L-gulonate TRAP transporter, small inner membrane subunit
Locus tag: b3578
Name: yiaN Funciton: predicted 3-dehydro-L-gulonate TRAP transporter, large inner membrane subunit
Locus tag: b3579
Name: yiaO Funciton: predicted 3-dehydro-L-gulonate TRAP transporter, substrate-binding periplasmic protein
Locus tag: b3580
Name: lyxK Funciton: L-xylulose kinase
Locus tag: b3581
Name: sgbH Funciton: 3-keto-L-gulonate 6-phosphate decarboxylase
Locus tag: b3582
Name: sgbU Funciton: putative 3-hexulose-6-phosphate isomerase
Locus tag: b3583
Name: sgbE Funciton: L-ribulose-5-phosphate 4-epimerase |
||||
yiaK-yiaL-yiaM-yiaN-yiaO-lyxK-sgbH-sgbU-sgbE | -70 | 6.4 | ATTTGAAATCAAGTTTCGCAT | b3575 |
Salmonella typhimurium LT2 | ||||
Position: -82
Score: 6.02193 Sequence: ATTTGGAACTAGATTTCGCAT
Locus tag: STM3668
Name: yiaK Funciton: 2,3-diketo-L-gulonate dehydrogenase, NADH-dependent
Locus tag: STM3669
Name: yiaL Funciton: hypothetical protein
Locus tag: STM3670
Name: cheX Funciton: putative chemotaxis protein
Locus tag: STM3671
Name: yiaM Funciton: predicted 3-dehydro-L-gulonate TRAP transporter, small inner membrane subunit
Locus tag: STM3672
Name: yiaN Funciton: predicted 3-dehydro-L-gulonate TRAP transporter, large inner membrane subunit
Locus tag: STM3673
Name: yiaO Funciton: predicted 3-dehydro-L-gulonate TRAP transporter, substrate-binding periplasmic protein
Locus tag: STM3674
Name: lyxK Funciton: L-xylulose kinase
Locus tag: STM3675
Name: sgbH Funciton: 3-keto-L-gulonate 6-phosphate decarboxylase
Locus tag: STM3676
Name: sgbU Funciton: putative 3-hexulose-6-phosphate isomerase
Locus tag: STM3677
Name: sgbE Funciton: L-ribulose-5-phosphate 4-epimerase |
||||
yiaK-yiaL-cheX-yiaM-yiaN-yiaO-lyxK-sgbH-sgbU-sgbE | -82 | 6 | ATTTGGAACTAGATTTCGCAT | STM3668 |
Serratia proteamaculans 568 | ||||
Position: -74
Score: 6.09968 Sequence: ATTTGAAATGCAATTCCGCAT
Locus tag: Spro_3933
Name: yiaK Funciton: 2,3-diketo-L-gulonate dehydrogenase, NADH-dependent
Locus tag: Spro_3934
Name: yiaL Funciton: hypothetical protein
Locus tag: Spro_3935
Name: sgbT Funciton: predicted 3-dehydro-L-gulonate MFS transporter
Locus tag: Spro_3936
Name: lyxK Funciton: L-xylulose kinase
Locus tag: Spro_3937
Name: sgbH Funciton: 3-keto-L-gulonate 6-phosphate decarboxylase
Locus tag: Spro_3938
Name: sgbU Funciton: putative 3-hexulose-6-phosphate isomerase
Locus tag: Spro_3939
Name: sgbE Funciton: L-ribulose-5-phosphate 4-epimerase |
||||
yiaK-yiaL-sgbT-lyxK-sgbH-sgbU-sgbE | -74 | 6.1 | ATTTGAAATGCAATTCCGCAT | Spro_3933 |