Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Orthologous regulated operons containing sgbU gene

Properties
Regulog: YiaJ - Enterobacteriales
Regulator type: Transcription factor
Regulator family: IclR
Regulation mode: repressor
Biological process: L-lyxose utilization
Effector: Ascorbate-6-phosphate
Phylum: Proteobacteria/gamma
Built upon 8 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Escherichia coli str. K-12 substr. MG1655
Position: -70
Score: 6.36801
Sequence: ATTTGAAATCAAGTTTCGCAT
Locus tag: b3575
Name: yiaK
Funciton: 2,3-diketo-L-gulonate dehydrogenase, NADH-dependent
Locus tag: b3576
Name: yiaL
Funciton: hypothetical protein
Locus tag: b3577
Name: yiaM
Funciton: predicted 3-dehydro-L-gulonate TRAP transporter, small inner membrane subunit
Locus tag: b3578
Name: yiaN
Funciton: predicted 3-dehydro-L-gulonate TRAP transporter, large inner membrane subunit
Locus tag: b3579
Name: yiaO
Funciton: predicted 3-dehydro-L-gulonate TRAP transporter, substrate-binding periplasmic protein
Locus tag: b3580
Name: lyxK
Funciton: L-xylulose kinase
Locus tag: b3581
Name: sgbH
Funciton: 3-keto-L-gulonate 6-phosphate decarboxylase
Locus tag: b3582
Name: sgbU
Funciton: putative 3-hexulose-6-phosphate isomerase
Locus tag: b3583
Name: sgbE
Funciton: L-ribulose-5-phosphate 4-epimerase
yiaK-yiaL-yiaM-yiaN-yiaO-lyxK-sgbH-sgbU-sgbE -70 6.4 ATTTGAAATCAAGTTTCGCAT b3575
Salmonella typhimurium LT2
Position: -82
Score: 6.02193
Sequence: ATTTGGAACTAGATTTCGCAT
Locus tag: STM3668
Name: yiaK
Funciton: 2,3-diketo-L-gulonate dehydrogenase, NADH-dependent
Locus tag: STM3669
Name: yiaL
Funciton: hypothetical protein
Locus tag: STM3670
Name: cheX
Funciton: putative chemotaxis protein
Locus tag: STM3671
Name: yiaM
Funciton: predicted 3-dehydro-L-gulonate TRAP transporter, small inner membrane subunit
Locus tag: STM3672
Name: yiaN
Funciton: predicted 3-dehydro-L-gulonate TRAP transporter, large inner membrane subunit
Locus tag: STM3673
Name: yiaO
Funciton: predicted 3-dehydro-L-gulonate TRAP transporter, substrate-binding periplasmic protein
Locus tag: STM3674
Name: lyxK
Funciton: L-xylulose kinase
Locus tag: STM3675
Name: sgbH
Funciton: 3-keto-L-gulonate 6-phosphate decarboxylase
Locus tag: STM3676
Name: sgbU
Funciton: putative 3-hexulose-6-phosphate isomerase
Locus tag: STM3677
Name: sgbE
Funciton: L-ribulose-5-phosphate 4-epimerase
yiaK-yiaL-cheX-yiaM-yiaN-yiaO-lyxK-sgbH-sgbU-sgbE -82 6 ATTTGGAACTAGATTTCGCAT STM3668
Serratia proteamaculans 568
Position: -74
Score: 6.09968
Sequence: ATTTGAAATGCAATTCCGCAT
Locus tag: Spro_3933
Name: yiaK
Funciton: 2,3-diketo-L-gulonate dehydrogenase, NADH-dependent
Locus tag: Spro_3934
Name: yiaL
Funciton: hypothetical protein
Locus tag: Spro_3935
Name: sgbT
Funciton: predicted 3-dehydro-L-gulonate MFS transporter
Locus tag: Spro_3936
Name: lyxK
Funciton: L-xylulose kinase
Locus tag: Spro_3937
Name: sgbH
Funciton: 3-keto-L-gulonate 6-phosphate decarboxylase
Locus tag: Spro_3938
Name: sgbU
Funciton: putative 3-hexulose-6-phosphate isomerase
Locus tag: Spro_3939
Name: sgbE
Funciton: L-ribulose-5-phosphate 4-epimerase
yiaK-yiaL-sgbT-lyxK-sgbH-sgbU-sgbE -74 6.1 ATTTGAAATGCAATTCCGCAT Spro_3933