Orthologous regulated operons containing cheX gene

Properties
Regulog:	YiaJ - Enterobacteriales
Regulator type:	Transcription factor
Regulator family:	IclR
Regulation mode:	repressor
Biological process:	L-lyxose utilization
Effector:	Ascorbate-6-phosphate
Phylum:	Proteobacteria/gamma

Built upon 8 sites [see more]

Orthologous operons
Operon	Position	Score	Sequence	Locus Tag of the First Gene
Citrobacter koseri ATCC BAA-895
Position: -72 Score: 6.54484 Sequence: ATTTGAAATCAGATTTCGCAT Locus tag: CKO_05033 Name: yiaK Funciton: 2,3-diketo-L-gulonate dehydrogenase, NADH-dependent Locus tag: CKO_05034 Name: yiaL Funciton: hypothetical protein Locus tag: CKO_05035 Name: cheX Funciton: putative chemotaxis protein Locus tag: CKO_05036 Name: sgbT Funciton: predicted 3-dehydro-L-gulonate MFS transporter Locus tag: CKO_05037 Name: lyxK Funciton: L-xylulose kinase
yiaK-yiaL-cheX-sgbT-lyxK	-72	6.5	ATTTGAAATCAGATTTCGCAT	CKO_05033
Salmonella typhimurium LT2
Position: -82 Score: 6.02193 Sequence: ATTTGGAACTAGATTTCGCAT Locus tag: STM3668 Name: yiaK Funciton: 2,3-diketo-L-gulonate dehydrogenase, NADH-dependent Locus tag: STM3669 Name: yiaL Funciton: hypothetical protein Locus tag: STM3670 Name: cheX Funciton: putative chemotaxis protein Locus tag: STM3671 Name: yiaM Funciton: predicted 3-dehydro-L-gulonate TRAP transporter, small inner membrane subunit Locus tag: STM3672 Name: yiaN Funciton: predicted 3-dehydro-L-gulonate TRAP transporter, large inner membrane subunit Locus tag: STM3673 Name: yiaO Funciton: predicted 3-dehydro-L-gulonate TRAP transporter, substrate-binding periplasmic protein Locus tag: STM3674 Name: lyxK Funciton: L-xylulose kinase Locus tag: STM3675 Name: sgbH Funciton: 3-keto-L-gulonate 6-phosphate decarboxylase Locus tag: STM3676 Name: sgbU Funciton: putative 3-hexulose-6-phosphate isomerase Locus tag: STM3677 Name: sgbE Funciton: L-ribulose-5-phosphate 4-epimerase
yiaK-yiaL-cheX-yiaM-yiaN-yiaO-lyxK-sgbH-sgbU-sgbE	-82	6	ATTTGGAACTAGATTTCGCAT	STM3668