Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Orthologous regulated operons containing yhcH gene

Properties
Regulog: YhcF - Bacillales
Regulator type: Transcription factor
Regulator family: GntR/Others
Regulation mode:
Biological process: Multidrug resistance; Multidrug efflux
Effector:
Phylum: Firmicutes
Built upon 6 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Bacillus amyloliquefaciens FZB42
Position: -46
Score: 6.38113
Sequence: GTGTACTATGTTACTCATACAC
Locus tag: RBAM_009320
Name: yhcE
Funciton: Putative integral inner membrane protein
Locus tag: RBAM_009330
Name: yhcF
Funciton: Transcriptional regulator, GntR family
Locus tag: RBAM_009340
Name: yhcG
Funciton: ABC-type multidrug transport system, ATPase component
Locus tag: RBAM_009350
Name: yhcH
Funciton: ABC transporter, ATP-binding protein
Locus tag: RBAM_009360
Name: yhcI
Funciton: ABC-type multidrug transport system, permease component
yhcE-yhcF-yhcG-yhcH-yhcI -46 6.4 GTGTACTATGTTACTCATACAC RBAM_009320
Bacillus subtilis subsp. subtilis str. 168
Position: -49
Score: 6.38113
Sequence: GTGTACTATGTTACTCATACAC
Locus tag: BSU09050
Name: yhcE
Funciton: Putative integral inner membrane protein
Locus tag: BSU09060
Name: yhcF
Funciton: Transcriptional regulator, GntR family
Locus tag: BSU09070
Name: yhcG
Funciton: ABC-type multidrug transport system, ATPase component
Locus tag: BSU09080
Name: yhcH
Funciton: ABC transporter, ATP-binding protein
Locus tag: BSU09090
Name: yhcI
Funciton: ABC-type multidrug transport system, permease component
yhcE-yhcF-yhcG-yhcH-yhcI -49 6.4 GTGTACTATGTTACTCATACAC BSU09050
Paenibacillus sp. JDR-2
Position: -44
Score: 5.52196
Sequence: GTGTACTATTCAACTATAACAC
Locus tag: Pjdr2_3932
Name: yhcH
Funciton: ABC transporter, ATP-binding protein
Locus tag: Pjdr2_3931
Name: yhcI
Funciton: ABC-type multidrug transport system, permease component
Locus tag: Pjdr2_3930
Name: yhcF
Funciton: Transcriptional regulator, GntR family
Locus tag: Pjdr2_3929
Name: yhcG
Funciton: ABC-type multidrug transport system, ATPase component
yhcH-yhcI-yhcF-yhcG -44 5.5 GTGTACTATTCAACTATAACAC Pjdr2_3932