Orthologous regulated operons containing yhcG gene

Properties
Regulog:	YhcF - Bacillales
Regulator type:	Transcription factor
Regulator family:	GntR/Others
Regulation mode:
Biological process:	Multidrug resistance; Multidrug efflux
Effector:
Phylum:	Firmicutes

Built upon 6 sites [see more]

Orthologous operons
Operon	Position	Score	Sequence	Locus Tag of the First Gene
Bacillus amyloliquefaciens FZB42
Position: -46 Score: 6.38113 Sequence: GTGTACTATGTTACTCATACAC Locus tag: RBAM_009320 Name: yhcE Funciton: Putative integral inner membrane protein Locus tag: RBAM_009330 Name: yhcF Funciton: Transcriptional regulator, GntR family Locus tag: RBAM_009340 Name: yhcG Funciton: ABC-type multidrug transport system, ATPase component Locus tag: RBAM_009350 Name: yhcH Funciton: ABC transporter, ATP-binding protein Locus tag: RBAM_009360 Name: yhcI Funciton: ABC-type multidrug transport system, permease component
yhcE-yhcF-yhcG-yhcH-yhcI	-46	6.4	GTGTACTATGTTACTCATACAC	RBAM_009320
Bacillus cereus ATCC 14579
Position: -43 Score: 6.87995 Sequence: GTGTATTATTTAACTAGTACAC Locus tag: BC1356 Name: yhcF Funciton: Transcriptional regulator, GntR family Locus tag: BC1357 Name: yhcG Funciton: ABC-type multidrug transport system, ATPase component Locus tag: BC1358 Name: null Funciton: ABC transporter permease protein Locus tag: BC1359 Name: bcrA Funciton: Bacitracin transport ATP-binding protein Locus tag: BC1360 Name: bcrB Funciton: Bacitracin transport permease protein
yhcF-yhcG-BC1358-bcrA-bcrB	-43	6.9	GTGTATTATTTAACTAGTACAC	BC1356
Bacillus halodurans C-125
Position: -51 Score: 5.96421 Sequence: GTGTACTATTTCATTAGCACAA Locus tag: BH0384 Name: BH0384 Funciton: Hypothetical protein Locus tag: BH0383 Name: yhcF Funciton: Transcriptional regulator, GntR family Locus tag: BH0382 Name: yhcG Funciton: ABC-type multidrug transport system, ATPase component
BH0384-yhcF-yhcG	-51	6	GTGTACTATTTCATTAGCACAA	BH0384
Bacillus subtilis subsp. subtilis str. 168
Position: -49 Score: 6.38113 Sequence: GTGTACTATGTTACTCATACAC Locus tag: BSU09050 Name: yhcE Funciton: Putative integral inner membrane protein Locus tag: BSU09060 Name: yhcF Funciton: Transcriptional regulator, GntR family Locus tag: BSU09070 Name: yhcG Funciton: ABC-type multidrug transport system, ATPase component Locus tag: BSU09080 Name: yhcH Funciton: ABC transporter, ATP-binding protein Locus tag: BSU09090 Name: yhcI Funciton: ABC-type multidrug transport system, permease component
yhcE-yhcF-yhcG-yhcH-yhcI	-49	6.4	GTGTACTATGTTACTCATACAC	BSU09050
Paenibacillus sp. JDR-2
Position: -44 Score: 5.52196 Sequence: GTGTACTATTCAACTATAACAC Locus tag: Pjdr2_3932 Name: yhcH Funciton: ABC transporter, ATP-binding protein Locus tag: Pjdr2_3931 Name: yhcI Funciton: ABC-type multidrug transport system, permease component Locus tag: Pjdr2_3930 Name: yhcF Funciton: Transcriptional regulator, GntR family Locus tag: Pjdr2_3929 Name: yhcG Funciton: ABC-type multidrug transport system, ATPase component
yhcH-yhcI-yhcF-yhcG	-44	5.5	GTGTACTATTCAACTATAACAC	Pjdr2_3932