Orthologous regulated operons containing frlM gene

Properties
Regulog:	FrlR - Bacillales
Regulator type:	Transcription factor
Regulator family:	GntR/Others
Regulation mode:	repressor
Biological process:	Fructoselysine utilization
Effector:	Fructoselysine 6-phosphate
Phylum:	Firmicutes

Built upon 12 sites [see more]

Orthologous operons
Operon	Position	Score	Sequence	Locus Tag of the First Gene
Bacillus amyloliquefaciens FZB42
Position: -32 Score: 5.24276 Sequence: CGGACTATAATGATATATAACG Position: -22 Score: 5.77875 Sequence: TGATATATAACGTTATAGTCCG Locus tag: RBAM_029660 Name: frlO Funciton: Putative fructoselysine ABC transporter, substrate-binding component Locus tag: RBAM_029650 Name: frlN Funciton: Putative fructoselysine ABC transporter, permease 2 component Locus tag: RBAM_029640 Name: frlM Funciton: Putative fructoselysine ABC transporter, permease component Locus tag: RBAM_029630 Name: frlD Funciton: Fructoselysine kinase
frlO-frlN-frlM-frlD	-32	5.2	CGGACTATAATGATATATAACG	RBAM_029660
	-22	5.8	TGATATATAACGTTATAGTCCG
Bacillus subtilis subsp. subtilis str. 168
Position: -54 Score: 6.09537 Sequence: TAGACTATAATGTTATATAACA Position: -44 Score: 6.09537 Sequence: TGTTATATAACATTATAGTCTA Locus tag: BSU32600 Name: frlO Funciton: Putative fructoselysine ABC transporter, substrate-binding component Locus tag: BSU32590 Name: frlN Funciton: Putative fructoselysine ABC transporter, permease 2 component Locus tag: BSU32580 Name: frlM Funciton: Putative fructoselysine ABC transporter, permease component Locus tag: BSU32570 Name: frlD Funciton: Fructoselysine kinase
frlO-frlN-frlM-frlD	-54	6.1	TAGACTATAATGTTATATAACA	BSU32600
	-44	6.1	TGTTATATAACATTATAGTCTA

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --