Orthologous regulated operons containing murQ2 gene
| Regulog: | NagR - Bacillales |
| Regulator type: | Transcription factor |
| Regulator family: | GntR/Others |
| Regulation mode: | repressor |
| Biological process: | N-acetylglucosamine utilization |
| Effector: | N-acetylglucosamine-6-phosphate |
| Phylum: | Firmicutes |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Bacillus licheniformis DSM 13 | ||||
|
Position: -72
Score: 6.13355 Sequence: TTATTGGTCTAGACAACTAG
Locus tag: BLi04348
Name: nagA Funciton: N-acetylglucosamine-6-phosphate deacetylase (EC 3.5.1.25)
Locus tag: BLi04349
Name: nagB Funciton: Glucosamine-6-phosphate deaminase (EC 3.5.99.6)
Locus tag: BLi04350
Name: nagR Funciton: Transcriptional regulator of N-acetylglucosamine utilization, GntR
Locus tag: BLi04351
Name: murQ2 Funciton: N-acetylmuramic acid 6-phosphate etherase (EC 4.2.-.-)
Locus tag: BLi04352
Name: nagP Funciton: PTS system, N-acetylglucosamine-specific IIB component (EC 2.7.1.69) / PTS system, N-acetylglucosamine-specific IIC component (EC 2.7.1.69) |
||||
| nagA-nagB-nagR-murQ2-nagP | -72 | 6.1 | TTATTGGTCTAGACAACTAG | BLi04348 |