Orthologous regulated operons containing ipdC gene
Regulog: | TyrR - Enterobacteriales |
Regulator type: | Transcription factor |
Regulator family: | TyrR |
Regulation mode: | activator (repressor) |
Biological process: | Aromatic amino acid metabolism |
Effector: | Tyrosine; Phenylalanine |
Phylum: | Proteobacteria/gamma |

Operon | Position | Score | Sequence | Locus Tag of the First Gene |
---|---|---|---|---|
Citrobacter koseri ATCC BAA-895 | ||||
Position: -101
Score: 3.80347 Sequence: CTGTAAATCCTGCTTTCCAC
Locus tag: CKO_00409
Name: ipdC Funciton: Indole-3-pyruvate decarboxylase (EC 4.1.1.74) |
||||
ipdC | -101 | 3.8 | CTGTAAATCCTGCTTTCCAC | CKO_00409 |
Klebsiella pneumoniae subsp. pneumoniae MGH 78578 | ||||
Position: -97
Score: 4.98754 Sequence: GCGTAATTATTGCTTTACAC
Locus tag: KPN_02740
Name: ipdC Funciton: Indole-3-pyruvate decarboxylase (EC 4.1.1.74) |
||||
ipdC | -97 | 5 | GCGTAATTATTGCTTTACAC | KPN_02740 |
Salmonella typhimurium LT2 | ||||
Position: -100
Score: 4.53897 Sequence: CTGTAAACATTGTTTTCCAG
Locus tag: STM2405
Name: ipdC Funciton: Indole-3-pyruvate decarboxylase (EC 4.1.1.74) |
||||
ipdC | -100 | 4.5 | CTGTAAACATTGTTTTCCAG | STM2405 |