Orthologous regulated operons containing Cyan7425_3445 gene

Properties
Regulog:	SufR - Cyanobacteria
Regulator type:	Transcription factor
Regulator family:	[Other]
Regulation mode:	repressor
Biological process:	Iron-sulfur cluster biogenesis
Effector:	Iron-sulfur cluster redox state
Phylum:	Cyanobacteria

Built upon 48 sites [see more]

Orthologous operons
Operon	Position	Score	Sequence	Locus Tag of the First Gene
Cyanothece sp. PCC 7425
Position: -106 Score: 5.00114 Sequence: TTAGACAACTGATGTGTTGCTAAA Position: -67 Score: 5.33647 Sequence: TTAAGCAACGCCTGAGTTGTTTAA Locus tag: Cyan7425_3450 Name: sufB Funciton: Iron-sulfur assembly protein Locus tag: Cyan7425_3449 Name: null Funciton: Hypothetical protein Locus tag: Cyan7425_3448 Name: null Funciton: Hypothetical protein Locus tag: Cyan7425_3447 Name: null Funciton: Hypothetical protein Locus tag: Cyan7425_3446 Name: Cyan7425_3446 Funciton: Predicted oxoglutarate/iron-dependent oxygenase Locus tag: Cyan7425_3445 Name: Cyan7425_3445 Funciton: Conserved hypothetical protein Locus tag: Cyan7425_3444 Name: sufC Funciton: Iron-sulfur assembly ATPase Locus tag: Cyan7425_3443 Name: sufD Funciton: Iron-sulfur assembly protein Locus tag: Cyan7425_3442 Name: sufS Funciton: Cysteine desulfurase (EC 2.8.1.7)
sufB-Cyan7425_3449-Cyan7425_3448-Cyan7425_3447-Cyan7425_3446-Cyan7425_3445-sufC-sufD-sufS	-106	5	TTAGACAACTGATGTGTTGCTAAA	Cyan7425_3450
	-67	5.3	TTAAGCAACGCCTGAGTTGTTTAA

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --