Regulon of CggR in Bacillus cereus ATCC 14579

Properties
Regulator type:	Transcription factor
TF locus tag:	BC5141
Regulator family:	SorC
Regulation mode:	repressor
Biological process:	Glycolysis
Effector:	Fructose-1,6-diphosphate
Regulog:	CggR - Bacillales
Statistics of regulated genes:
- Genes	2
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 12 sites [see more]

Member of regulog collections

By taxonomy - Bacillales
By TF family - SorC
By effector - Fructose-1,6-diphosphate
By pathway - Glycolysis

Regulated operons
	Locus Tag	Name	Function
Position: -61 Score: 8.1 Sequence: TGGGACACAAAATGTCACTACGGGACGTAAAGTGACC Locus tag: BC5141 Name: cggR Funciton: Transcriptional regulator of central glycolytic gene, SorC family Locus tag: BC5140 Name: gapA Funciton: NAD-dependent glyceraldehyde-3-phosphate dehydrogenase (EC 1.2.1.12)
	BC5141	cggR	Transcriptional regulator of central glycolytic gene, SorC family
	BC5140	gapA	NAD-dependent glyceraldehyde-3-phosphate dehydrogenase (EC 1.2.1.12)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD