Regulon of MurR in Staphylococcus epidermidis ATCC 12228

Properties
Regulator type:	Transcription factor
TF locus tag:	SE1891
Regulator family:	RpiR
Regulation mode:	repressor
Biological process:	N-acetylmuramate utilization
Effector:	N-acetylmuramate-6-phosphate
Regulog:	MurR - Staphylococcaceae
Statistics of regulated genes:
- Genes	4
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 7 sites [see more]

Member of regulog collections

By taxonomy - Staphylococcaceae
By TF family - RpiR
By effector - N-acetylmuramate-6-phosphate
By pathway - N-acetylmuramate utilization

Regulated operons
	Locus Tag	Name	Function
Position: -66 Score: 5.3 Sequence: AATTGTAAACTTGTTGCAATA Locus tag: SE1888 Name: SA0184 Funciton: Outer surface protein of unknown function, N-acetylmuramate-related Locus tag: SE1889 Name: murQ Funciton: N-acetylmuramic acid 6-phosphate etherase (EC 4.2.-.-) Locus tag: SE1890 Name: murT Funciton: predicted N-acetylmuramate PTS system, IIBC components Locus tag: SE1891 Name: murR Funciton: predicted N-acetylmuramate-6-phosphate-responsive transcriptional regulator, RpiR family
	SE1888	SA0184	Outer surface protein of unknown function, N-acetylmuramate-related
	SE1889	murQ	N-acetylmuramic acid 6-phosphate etherase (EC 4.2.-.-)
	SE1890	murT	predicted N-acetylmuramate PTS system, IIBC components
	SE1891	murR	predicted N-acetylmuramate-6-phosphate-responsive transcriptional regulator, RpiR family

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD