Regulon of MurR in Staphylococcus aureus subsp. aureus N315

Properties
Regulator type:	Transcription factor
TF locus tag:	SA0187
Regulator family:	RpiR
Regulation mode:	repressor
Biological process:	N-acetylmuramate utilization
Effector:	N-acetylmuramate-6-phosphate
Regulog:	MurR - Staphylococcaceae
Statistics of regulated genes:
- Genes	4
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 7 sites [see more]

Member of regulog collections

By taxonomy - Staphylococcaceae
By TF family - RpiR
By effector - N-acetylmuramate-6-phosphate
By pathway - N-acetylmuramate utilization

Regulated operons
	Locus Tag	Name	Function
Position: -133 Score: 5.4 Sequence: ATATGTAAGATTATTACAATG Locus tag: SA0184 Name: SA0184 Funciton: Outer surface protein of unknown function, N-acetylmuramate-related Locus tag: SA0185 Name: murQ Funciton: N-acetylmuramic acid 6-phosphate etherase (EC 4.2.-.-) Locus tag: SA0186 Name: murT Funciton: predicted N-acetylmuramate PTS system, IIBC components Locus tag: SA0187 Name: murR Funciton: predicted N-acetylmuramate-6-phosphate-responsive transcriptional regulator, RpiR family
	SA0184	SA0184	Outer surface protein of unknown function, N-acetylmuramate-related
	SA0185	murQ	N-acetylmuramic acid 6-phosphate etherase (EC 4.2.-.-)
	SA0186	murT	predicted N-acetylmuramate PTS system, IIBC components
	SA0187	murR	predicted N-acetylmuramate-6-phosphate-responsive transcriptional regulator, RpiR family

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD