Regulon of EutR in Mycobacterium vanbaalenii PYR-1

Properties
Regulator type:	Transcription factor
TF locus tag:	Mvan_2922
Regulator family:	RpiR
Regulation mode:
Biological process:	Ethanolamine utilization
Effector:	Ethanolamine
Regulog:	EutR - Mycobacteriaceae
Statistics of regulated genes:
- Genes	7
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 6 sites [see more]

Member of regulog collections

By taxonomy - Mycobacteriaceae
By TF family - RpiR
By effector - Ethanolamine
By pathway - Ethanolamine utilization

Regulated operons
	Locus Tag	Name	Function
Position: -62 Score: 4.8 Sequence: GCTGAAACATTTATGACATA Locus tag: Mvan_2920 Name: eutB Funciton: glutamine synthetase family protein Locus tag: Mvan_2919 Name: eutT Funciton: Ethanolamine permease, APC family Locus tag: Mvan_2918 Name: null Funciton: small molecule metabolism; central intermediary metabolism; amino acids Locus tag: Mvan_2917 Name: PF04909 Funciton: Amidohydrolase 2 Locus tag: Mvan_2916 Name: COG1982 Funciton: Arginine/lysine/ornithine decarboxylases
	Mvan_2920	eutB	glutamine synthetase family protein
	Mvan_2919	eutT	Ethanolamine permease, APC family
	Mvan_2918		small molecule metabolism; central intermediary metabolism; amino acids
	Mvan_2917	PF04909	Amidohydrolase 2
	Mvan_2916	COG1982	Arginine/lysine/ornithine decarboxylases
Position: -86 Score: 4.8 Sequence: TATGTCATAAATGTTTCAGC Locus tag: Mvan_2921 Name: COG0121 Funciton: Predicted glutamine amidotransferase Locus tag: Mvan_2922 Name: eutR Funciton: Transcriptional regulator of ethanolamine utilization, RpiR family
	Mvan_2921	COG0121	Predicted glutamine amidotransferase
	Mvan_2922	eutR	Transcriptional regulator of ethanolamine utilization, RpiR family

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD