Regulon of EutR in Burkholderia sp. 383

Properties
Regulator type:	Transcription factor
TF locus tag:	Bcep18194_B0995
Regulator family:	RpiR
Regulation mode:
Biological process:
Effector:
Regulog:	EutR - Burkholderia
Statistics of regulated genes:
- Genes	3
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 9 sites [see more]

Member of regulog collections

By taxonomy - Burkholderia
By TF family - RpiR

Regulated operons
	Locus Tag	Name	Function
Position: -216 Score: 4.9 Sequence: TCTGTAATAAAACAAACATA Position: -100 Score: 5.7 Sequence: AATGTATTGTTTATTACATG Locus tag: Bcep18194_B0996 Name: PF01019 Funciton: Gamma-glutamyltranspeptidase (EC 2.3.2.2) Locus tag: Bcep18194_B0997 Name: PF00375 Funciton: C4-dicarboxylate transport protein
	Bcep18194_B0996	PF01019	Gamma-glutamyltranspeptidase (EC 2.3.2.2)
	Bcep18194_B0997	PF00375	C4-dicarboxylate transport protein
Position: -167 Score: 4.9 Sequence: TATGTTTGTTTTATTACAGA Locus tag: Bcep18194_B0995 Name: eutR Funciton: Transcriptional regulator of ethanolamine utilization, RpiR family
	Bcep18194_B0995	eutR	Transcriptional regulator of ethanolamine utilization, RpiR family

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD