Regulon of SorC in Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Properties
Regulator type:	Transcription factor
TF locus tag:	KPN_04408
Regulator family:	SorC
Regulation mode:	activator (repressor)
Biological process:	Sorbose utilization
Effector:	Sorbose
Regulog:	SorC - Enterobacteriales
Statistics of regulated genes:
- Genes	7
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 1 sites [see more]

Member of regulog collections

By taxonomy - Enterobacteriales
By TF family - SorC
By effector - Sorbose
By pathway - Sorbose utilization

Regulated operons
	Locus Tag	Name	Function
Position: -28 Score: 6.5 Sequence: ATTTGCACAAATGTGCAGGA Locus tag: KPN_04408 Name: sorC Funciton: Sorbitol utilization transcriptional regulator, SorC family Locus tag: KPN_04407 Name: sorD Funciton: Sorbitol-6-phosphate 2-dehydrogenase (EC 1.1.1.140) Locus tag: KPN_04406 Name: sorF Funciton: Sorbose-specific PTS, EIIA component Locus tag: KPN_04405 Name: sorB Funciton: Sorbose-specific PTS, EIIB component Locus tag: KPN_04404 Name: sorA Funciton: Sorbose-specific PTS, EIIC component Locus tag: KPN_04403 Name: sorM Funciton: Sorbose-specific PTS, EIID component Locus tag: KPN_04402 Name: sorE Funciton: L-sorbose 1-phosphate reductase (EC 1.1.1.-)
	KPN_04408	sorC	Sorbitol utilization transcriptional regulator, SorC family
	KPN_04407	sorD	Sorbitol-6-phosphate 2-dehydrogenase (EC 1.1.1.140)
	KPN_04406	sorF	Sorbose-specific PTS, EIIA component
	KPN_04405	sorB	Sorbose-specific PTS, EIIB component
	KPN_04404	sorA	Sorbose-specific PTS, EIIC component
	KPN_04403	sorM	Sorbose-specific PTS, EIID component
	KPN_04402	sorE	L-sorbose 1-phosphate reductase (EC 1.1.1.-)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD