Regulon of SusR2 in Bacteroides uniformis ATCC 8492

Properties
Regulator type:	Transcription factor
TF locus tag:	BACUNI_01940
Regulator family:	[Other]
Regulation mode:	repressor
Biological process:	Starch utilization
Effector:
Regulog:	SusR2 - Bacteroidaceae
Statistics of regulated genes:
- Genes	7
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 10 sites [see more]

Member of regulog collections

By taxonomy - Bacteroidaceae
By TF family - [Other]
By pathway - Starch utilization

Regulated operons
	Locus Tag	Name	Function
Position: -206 Score: 6.2 Sequence: ATTTTCACTACTTTTTTAGT Position: -129 Score: 6.5 Sequence: TAAACCACTACTTTTTTACT Locus tag: BACUNI_01942 Name: susC2 Funciton: SusC2, outer membrane protein involved in starch binding Locus tag: BACUNI_01943 Name: susD2 Funciton: SusD2, outer membrane protein involved in starch binding Locus tag: BACUNI_01944 Name: susD2 Funciton: SusD2, outer membrane protein involved in starch binding Locus tag: BACUNI_01945 Name: susE2 Funciton: Outer membrane protein SusE2 Locus tag: BACUNI_01946 Name: dexA Funciton: Dextranase (EC 3.2.1.11) Locus tag: BACUNI_01947 Name: gaa Funciton: Glucan 1,3-alpha-glucosidase (EC 3.2.1.84) Locus tag: BACUNI_01948 Name: susB2 Funciton: Alpha-glucosidase SusB2 (EC 3.2.1.20)
	BACUNI_01942	susC2	SusC2, outer membrane protein involved in starch binding
	BACUNI_01943	susD2	SusD2, outer membrane protein involved in starch binding
	BACUNI_01944	susD2	SusD2, outer membrane protein involved in starch binding
	BACUNI_01945	susE2	Outer membrane protein SusE2
	BACUNI_01946	dexA	Dextranase (EC 3.2.1.11)
	BACUNI_01947	gaa	Glucan 1,3-alpha-glucosidase (EC 3.2.1.84)
	BACUNI_01948	susB2	Alpha-glucosidase SusB2 (EC 3.2.1.20)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD