Regulon of SusR2 in Bacteroides thetaiotaomicron VPI-5482

Properties
Regulator type:	Transcription factor
TF locus tag:	BT3091
Regulator family:	[Other]
Regulation mode:	repressor
Biological process:	Starch utilization
Effector:
Regulog:	SusR2 - Bacteroidaceae
Statistics of regulated genes:
- Genes	5
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 10 sites [see more]

Member of regulog collections

By taxonomy - Bacteroidaceae
By TF family - [Other]
By pathway - Starch utilization

Regulated operons
	Locus Tag	Name	Function
Position: -186 Score: 6.1 Sequence: AAATCCACTACTTTTTTAGC Position: -109 Score: 5.9 Sequence: TAAACCACTATATTTTTGCT Locus tag: BT3090 Name: susC2 Funciton: SusC2, outer membrane protein involved in starch binding Locus tag: BT3089 Name: susD2 Funciton: SusD2, outer membrane protein involved in starch binding Locus tag: BT3088 Name: susE2 Funciton: Outer membrane protein SusE2 Locus tag: BT3087 Name: dexA Funciton: Dextranase (EC 3.2.1.11) Locus tag: BT3086 Name: gaa Funciton: Glucan 1,3-alpha-glucosidase (EC 3.2.1.84)
	BT3090	susC2	SusC2, outer membrane protein involved in starch binding
	BT3089	susD2	SusD2, outer membrane protein involved in starch binding
	BT3088	susE2	Outer membrane protein SusE2
	BT3087	dexA	Dextranase (EC 3.2.1.11)
	BT3086	gaa	Glucan 1,3-alpha-glucosidase (EC 3.2.1.84)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD