Regulon of SusR2 in Bacteroides ovatus ATCC 8483

Properties
Regulator type:	Transcription factor
TF locus tag:	BACOVA_02788
Regulator family:	[Other]
Regulation mode:	repressor
Biological process:	Starch utilization
Effector:
Regulog:	SusR2 - Bacteroidaceae
Statistics of regulated genes:
- Genes	5
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 10 sites [see more]

Member of regulog collections

By taxonomy - Bacteroidaceae
By TF family - [Other]
By pathway - Starch utilization

Regulated operons
	Locus Tag	Name	Function
Position: -204 Score: 6.6 Sequence: AAAATCACTACTTTTTTAGT Position: -127 Score: 5.9 Sequence: TAAATCACTATATTTTTGCT Locus tag: BACOVA_02787 Name: susC2 Funciton: SusC2, outer membrane protein involved in starch binding Locus tag: BACOVA_02786 Name: susD2 Funciton: SusD2, outer membrane protein involved in starch binding Locus tag: BACOVA_02785 Name: susE2 Funciton: Outer membrane protein SusE2 Locus tag: BACOVA_02784 Name: dexA Funciton: Dextranase (EC 3.2.1.11) Locus tag: BACOVA_02783 Name: gaa Funciton: Glucan 1,3-alpha-glucosidase (EC 3.2.1.84)
	BACOVA_02787	susC2	SusC2, outer membrane protein involved in starch binding
	BACOVA_02786	susD2	SusD2, outer membrane protein involved in starch binding
	BACOVA_02785	susE2	Outer membrane protein SusE2
	BACOVA_02784	dexA	Dextranase (EC 3.2.1.11)
	BACOVA_02783	gaa	Glucan 1,3-alpha-glucosidase (EC 3.2.1.84)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD